GenePrediction:GLEAN_7302 Details

Name: GLEAN_7302
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2875470..2873072 (- strand)
Length: 2399
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2875470..2874987 (- strand)
Length: 484
Type: CDS
Source: GLEAN
Position: GCSC_140:2874722..2874499 (- strand)
Length: 224
Type: CDS
Source: GLEAN
Position: GCSC_140:2874430..2873072 (- strand)
Length: 1359
>GLEAN_7302 class=GenePrediction position=GCSC_140:2875470..2873072 (- strand)
ATGGCTGAAGTTTCCTCTGAAACTATCGTTCCGGTTCAGATCGAGGAGGCGGATTATACGTTTGGCAGCCCGTCGAATGG
AGGAAATACCGAAGACGATTTCGATTTCGACTTGGGCGATGACAAGACACTTGGGCTGTTGACGGAAAACGGTGATGACT
ACAATACAGAAGTGGTAGAAGACTTCCAATCACATATGGCACAAGCCGAAGACGAGGATGAGATAGGCTACGAAGGTGGC
GGAGCGCCCGTGGGGGGTGAAAACGGCGACGGCGACGAACATGCACACGATGAGACCGGACACGACGATGAGATTGACTA
CGATGAGGCTGATCTCCAAACTACTTCTTTGAGTGCTGGCAATATCGTGTTGGACGAGAAACAGGAAGTGGACACTGCAG
AGGAGGCCCACGATGCTATTGACTTTGAAACCGAGACAAACAGGGCAGCTCCCAATTCACCAGAACATGATGTGGTAGAT
GAAGGTGAAACAGAACAATTTTCACTCGATGAAGGCGATCATGAAGTACAGGGTGTCAGCAAATTCGAGGAATATGACGG
CCAAGAGGGCGAAGAGAACGACGAAGAGTTTGAAGAAGAAGCTGGGGACGGCGAAGATGATGGTGAACGAGAGGACGAAG
GAGAGTATGGCGGAGAAGAATACGATGGAGATGATGACGCAGAAGAGATGGACAGCCCAGAAGGATCTTTAAATGTTGGA
CTCGGTCACCTGCATAGCCCACACTCAGCGTCCACTGCCGATGTTACCGTCACATGGGGCACTGAAGTTTGCCCCCTCTT
TAAGACATCCGAAGTTGACAGTCCGGATTCTTTTTTCCTTGAAGACCTTGAGGCGGCAAATTATCCGTTGTCAAAGTTTT
TGCTCACAATACGGAGTGGAATTGCGTCGTGGGTGCATGCGGAAGACGAGATTTTCATCCGCATCGATGATCTCGGGTTT
GAATTTGGAGAGGTATGTTTTGAACAGGCACCGCTAGACCCTCCCTCATGCTTGAACGGCCAACTAATCCATTACAAAAG
ACTACAACGGAAGCGCTTCTCGACCAGGTCACATTCCATAACCTGATTGCGTTGCACAACACACTCCTTACAAACGATGA
TGCTACACTTTCAAAGGGCTTGCATATAACCCTTGGCACACGGCCGAACTGCTTGCTGCGTCTGAAGAAGCTTGTCAGTG
AAGCAGGCTCGGGGAAGGGCCTTTCGTCTTGTCAGCAGACGGCAGCTGACTCGGACGCTTCCTCTGACTCGGACGACCAC
GCTGACAAGTCTGACGAGCAATCCTCTGATAATGGGTTAATGGACAGAGTTGAAGAGGAAGAGGGTGGTGCCCTGACTCC
GGAAGCAGAAATGGCCGATGTTGATGTAACAGTTGAGGAGACAGAGCCGTTCGGTGGTGAAGGAGCCGAACTTGCTACTG
CAGAGGATGGCACTGAATCTGTCGACCATGATGTTGATGTCGAGACTGAAGGTGGCCACGGCGTGGAGGTTGCCGCAGAA
GAAGCCGAATTAGTCGATTTTACGAATGAAGAGGAAGACGATACTGGCGGTGTGTCCCTCCGGACCACTGGTGGTCTTGA
GTTGGCACGAGGAGGTCATACACCCAGCGAGGCTAGCAACGGCCATTTCGAGCAACAAAGCAAACTTAGCGAGCATGAAA
CGGCCGAAGAGGTCGGGAATCCAGATCAACACCTTAAATCGGATATTATGGAACCCCTGGACCAAACTGGTGGATCACCA
GACCAAGAAAAAGATGGCGAACTATACAAGCCGGTACTTAGTATCTCAAACGGCGGAATATCTGACGATCCTCTGGAAGA
CTCAGTATTGGCCCATCTCGAGCCCGCCAACGGGCTCGAAGCTATTGACCAAGGCCACCAGTTGGGCGACTTGCAAGCCC
TGGGCGAGGAGGACAATGGTGACGGCTTTCTAGATGTCAGCGGTGACTTCGATGCCGTTCTACTCCCAACGACCGTGTCC
GAATGGGCAGGTGACGACAAGGCAGCCCTCGATGAGATGGATCTGTCACTTGATGCCAGCGTTACCGCTACGTTAGACCA
TGATGAGATCGACTACGAGGACCGCGATACTACTGGATTGCTCGGTACTGAGTTTGGAGAGGATGCCCGAATGATGTCTA
CCGAAGCTACCCTTCACAATACGGATGTGCCAGAGTCCGTTGCTGCCGCAGATGCAGGGCCCGATGAAATTGACTGGGAC
GACGACGATAAGAACGGTGCTGCCAGCGAGACAGCGTCAACCTCAGCAACAGCAACTGGCAAACGGACAAGGATAGATGA
AGGCTTGGAAGATTATCTCATTGATGACCTGCCAGGTAAAAGACACTTCCCTGATTGTGTCGCAATGAACCGCTGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62