GenePrediction:GLEAN_7303 Details

Name: GLEAN_7303
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2870275..2869093 (- strand)
Length: 1183
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2870275..2870014 (- strand)
Length: 262
Type: CDS
Source: GLEAN
Position: GCSC_140:2869958..2869667 (- strand)
Length: 292
Type: CDS
Source: GLEAN
Position: GCSC_140:2869609..2869093 (- strand)
Length: 517
>GLEAN_7303 class=GenePrediction position=GCSC_140:2870275..2869093 (- strand)
ATGCGCACAGTGGTCATTGGCGAGATTTGCAACTTTGCCGCGTACGCCTTTGCACCGGCTATCCTCGTCACTCCTCTCGG
CGCTCTCAGTGTTTTGGTTGGTGCCGTGCTCGGCTCATACTTCCTCAACGAGATATTGGGAACATTAGGAAAGCTCGGAA
GTGCCATCTGCCTTATCGGAGCTGTGATAATTGTGCTCCATGCGCCAGCTGACGAGGAAATCTCCACCATTGACGAGATT
TTGAACGATGCTATCAAGCCAGGTACGCCGAACAGCACCGCTCCGTTTTATTATGTACATGCTAACCGTAGCTACAGGCT
TCCTGTTGTATGCACTTGCCGTCACAGTTTACGCGGTCGTCGCTATTTACAAGGTGGCCCCTGTGTATGGAAAGAAAAAC
CCGCTGATCTACCTGAGCATTTGCTCGCTGGTCGGCTCTGTTTCTGTCATGTCGGTCAAGGCCTTCGGCATCGCCCTGAA
GCTCACATTTTCTGGGAACAACCAGTTCACTCACCCTTCCACTTACGTGTTCATGATTGTCACCGGCGTGTGCATTCTCA
CGCAGATGAACTACTTCAACAAAGCCCTCAGCCAGTTCCCAACAAACATGTGAGTATCGGTTGTTAAAGCTCCTTCTGAT
TTGAGTTGGGGGTTCTAACCGCACAGTGTCAACCCACTTTACTATGTCACATTCACAACCGCCACCCTTTGCGCATCTTT
CATTCTTTTCAGCGGCTTCAACACCACGGAGACGGTTAACACTCTGTCCCTGATCTGTGGTTTTCTCATTACCTTCACTG
GGGTCTACCTGCTCAATCTTTCCCGCGGCGACCCAGATGGCACTCGCATGGCCGGCCGATCTGGACCCGATGCGACTGGC
ACCGACATGATCTCGAGCATCCAGACTCGCATGAGCATGGAAGCTCGCCGCAGCTTCGGCCCCAGCCACCGTCGCAGCCT
CAGCAACGGCAGCGCCGGTGATCGACAAGGCCTGATAAGAGCCTATGATGAAGAGGAGGCAGCTGGCTTCGGCCTGGCTG
ACCTTACTGACTACGCCGAGGACGGAACCGTGCACGATGGCCTGACCGGCCCGTCAAACGGCTCTGCGAACGGCCAATTC
AAGAAGAGCAGCGCACAACCTAAGGGCTCAATAGAGCAGTCGACAAAGCCTGCCGACCGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62