GenePrediction:GLEAN_7305 Details

Name: GLEAN_7305
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2861946..2859420 (- strand)
Length: 2527
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2861946..2861884 (- strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_140:2861797..2861692 (- strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_140:2861446..2861295 (- strand)
Length: 152
Type: CDS
Source: GLEAN
Position: GCSC_140:2861220..2860729 (- strand)
Length: 492
Type: CDS
Source: GLEAN
Position: GCSC_140:2860667..2860408 (- strand)
Length: 260
Type: CDS
Source: GLEAN
Position: GCSC_140:2860340..2860240 (- strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_140:2860178..2859841 (- strand)
Length: 338
Type: CDS
Source: GLEAN
Position: GCSC_140:2859776..2859420 (- strand)
Length: 357
>GLEAN_7305 class=GenePrediction position=GCSC_140:2861946..2859420 (- strand)
ATGGCAGACGCGCCCACCAACGACGAGCTCTACCCCATCGCCGTCCTCATCGACGAGCTCAAGGTATGTTCCGAAAGGAA
GCGTTCGGCCGGGACGTGCTGTGAGATATAGGCTGACCGTCTCGCTCGTTCGGTTGCCGCTACTTCTAGCACGACGATGT
TCTGCTCCGCCTGAATGCCATCCACCGCCTTTCCACAATCGCCCTCGCTCTCGGCGCAGAGCGCACCCGGGATGAGCTGA
TTCCCTTTCTCGATGGTCGGTGTCACTGTCTCTGTCTCTTTTCACCTCCTTATCACCCCTCCTCCCATCTGTCCCTTCCT
CCCGTCTGTCGCGGTGTGTTTTCGCGTCTCGGGCGAGGATGAGGCATTATTGGCGAAAGCGGACGATCGACAGGACCGCC
AGCAGATGACGCGACGTGGACGGCCAGGGATGCCGGAAAGATGGACGGTTCGAGTTCTCGGATGTGGGACCGTGTTTCGC
TGACCAGCCCGTTATCACAGAATCGGTCGAGGATGAAGATGAGGTGCTCGTTGCTCTGAGCGAGGAGCTGGGCAACTTCA
TCGAGTATGTCGGCGGTTCCCAATGGGGCCATGTCCTGCTGTCGCCCTTGGAGAATCTGGCGGCAATCGAAGAGCCCGTT
GTGCGGGATAAGGTTCGTGCTGTTAACGGGAGCTTGCTATCCATCCCTTGTCATCGCCCTTCCCTGACTAATCCGGTCGT
TTGCAGGCTGTCGAGTCTCTCAACAAAATCTGCGAGCAGCTCTCGGCAAAACAGGTCGAGGACTACTTCGTCCCCTTGAC
CGTTCGGCTGTCCAAAGCCGACTGGTTCACATCCAAGGTGTCGGGCTGTGGCCTGTACACCACTCCCTACAAGAAGGTGC
CACCCACTGTACAGGAACAGCTCCGCCAGCAGTTCGGACACCTTGTCCACGATGAGACGCCGATGGTCCGGCGCCAGGCC
GCCACACACATGCCTGGCTTCGTCAAGGAGATGCCCGCTGCTATTGTGATTGACGAGATGATACCCCTGTTTCAACATCT
GGCTCAGGACGACCAGGACAGCGTGCGCCTCTTGACTGTCCAGATCCTTATCGCCATTGCCCAAGTTGTCCCGAAGGAGC
AGCAGGCCAGCCACGGCGTTCTTCTGACGGCCCTCCGCAGCCTGATAGAAGACAAGAGCTGGAGAGTTCGCTACATGGTG
GCGGAGCATTTCGAAGAGGTATGCTTTCGTCCGCGCGTTCCGCGCTTGCCGTTGCATGTGACTAACGCGATCGTTGTAGA
TCGCAAAGGCTGTGGACGAGGAGGTTGTGGCGAGAGATCTGGTCCCGGCATTTGTGAAGCTGCTGAAAGACAACGAGGCC
GAGGTGCGGACGGCCATTGCCGGCCAAATACCCGGCTTCTGTGCCCTGGTGGACCGCGAGATTCTCCTGAACGAGATCAT
GCCCAGTGTCGAGGACCTCGTGTCCGACACGTCGCAGCATGTTCGCGCGGCTCTCGGCACACAGATCTCGGGCCTGGCGC
CAATCCTGGGCAAGCAAGAGTGCGTCGGCCCCAAGATATGACCCCGGCCGTGGAAGGCTATTTCTAGTGCTAATGCGCAA
ATGCAGGACTATCGACCATCTTTTGCCCATGTTCCTCCAAATGCTCAAGGACGAATTCCCGGAAGTACGCCTTCACATCA
TCTCCAAGTTGGAGCTAGTTAATAAAGGTACGGGACAGCCGAAGAGGTGTGCGAGGGTGGCATCGACATGCTCACGCAGT
GTTTCTAGTGATCGGCATCGAGCTTCTCTCCCAGTCGCTGCTGCCGGCAATCGTGCAGCTGGCCGAGGACAAGCAATGGA
GAGTGCGGCTTGCCATTATCGAGTACATCCCACTGCTGGCCAGCCAGCTGGGCGTGCAGTTTTTTGATGAGAAGCTGAGC
AACCTATGTATGGGATGGCTCGGAGACACAGTCTTCTCGATCCGGGAGGCGGCCACACACAACCTGAAGAATCTGACGGA
AGTGTTTGGCGTCGACTGGGCCAGCGAGGCCATCATTCCCAAGGTGATGACCATGGGCAGCCACACGAACTACCTGTACC
GCATGACGACCTGCTTTGCCATAACGGTGCGTGCCCCCCGAAAAGTGTCCGATTACGGCTCCTCGTTTTGCCTACTGACG
TTGTTTCCAGACGCTCGCCTCCGTTGTCAGCCTGAACGTCATCGACAAGCACATCCTTCCGATGCTGGACAAGCTTGTTG
TGGACGACATCCCCAACATCCGTTTCAATGTGGCCAAGACGTACGGTGTGCTGATCGACGTGCTTAAGCGGTTGCCAGAC
CAGGGAACACTGTACTCGCTTGAGAAGCAGGGCAGCACAGAAGCACCATCGACAAAAGGGGCCGAGCTGATTCAGAGCCG
GATCCTGCCGAGCTTGGAGAAGCTGCAGAAGGACGACGACGTCGATGTGCGGTACTTTGCGACGACAGCGGCGGCTGTGG
CAACAGGAGCTGTGCCAGGCGGAGACCCGATGAATACCTCTCCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62