GenePrediction:GLEAN_7306 Details

Name: GLEAN_7306
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2858540..2857978 (- strand)
Length: 563
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2858540..2858383 (- strand)
Length: 158
Type: CDS
Source: GLEAN
Position: GCSC_140:2858287..2857978 (- strand)
Length: 310
>GLEAN_7306 class=GenePrediction position=GCSC_140:2858540..2857978 (- strand)
ATGGCCAACCAGACATCGGCCTCGGCCACGACGGCGAATGCGCCATCCACGCCGGTCAAGGTGCCTTCGGCTGCGGCCAG
CTACACGCCGGCCACGCTGGATCCAGACCTGCGGTCTCAGATCAACATGGTGCTCATCCGCGACGGCCACGTCTCCAAGT
AGGTAGCGGTAGCCCGGAGTGGCCACCCCCCCCCCCCTTCTCTGTCCAGATCGCCTCGCTAACCAGGCCTGCTTGCTCGC
ACCATCGCAACAGGATCCAGGACCATCTCCTTCACATCCTCCATGCCGACTCGTCCAACTGGCCGGCCGCCATTCAGGCC
CACGCCCTGCAGCTGCTGCGCTCGGGCGACTACACCAACTTTCCCGCGCTGATGCGACGCGTCATGGACGACATCCGCCG
CGACACCCTCGCCACGCCAAACGGCGACGGCACCGCAGACAAGAAAGGCAGCAGCCCGGCCGCATCCCTGGCCCTGCCCA
AGACCGTCGTCGACGAGGCGTTGCGGGTCACCCGCGAAAGCCTGGAGATGGTCTGCGAAATCGAAGAGAACGGGTCCCTG
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62