GenePrediction:GLEAN_7307 Details

Name: GLEAN_7307
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2847183..2846022 (- strand)
Length: 1162
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2847183..2846867 (- strand)
Length: 317
Type: CDS
Source: GLEAN
Position: GCSC_140:2846630..2846436 (- strand)
Length: 195
Type: CDS
Source: GLEAN
Position: GCSC_140:2846334..2846022 (- strand)
Length: 313
>GLEAN_7307 class=GenePrediction position=GCSC_140:2847183..2846022 (- strand)
ATGGAAAGCATCGTGCATAGAGGGGCCCAGCCCAGCCCGACGTCCTCGCCGGAGCTCAACCCGCTCCGGCTGGGCGATCG
GGGCAGCCGGAGTGACAATGACACCGACACCGACAGTGACGTGCTCGCGCCGCTACCAGAGTACAAGGCTGCGGGCGAGA
CGGTGCTCGATTTTGACGGGCTGCTACGGCCGGCGCCGGCGCTGCGACTGCGTGAGGACCTGACCGAAGGCTGTGGCGGC
CAGACGTGGCCGGCTGGCATGGTGCTGGCACGGCATCTGCTGCGGCACCGACGGGCGGAGATGGAGACAGCGCGAATGTG
AGTTTGGGTGGGGAGAGGAGGGGAGAGAGAAGACGGAAAGAGGAGAATGAGAGAGGAGAGAGGAGAGGAAAAGAGGAGAG
AGGAGAGGGAAGAAATGATGGGATGGGATGAGAGAAGAAACGAGACAAAAGGAGACGAAAAGAGAGAGGAAGAGAGGGAA
AGGCGAACGAAAGAGAGTAAAAGGAAGAGAGAAAGATACACATAGGTGCAAGTTCCTTGCTAACACTCGGCAGCCTCGAG
CTGGGTTCTGGCGGTGGCCTCGTCGGCTTGGCATTGGCACTCGCCTGCCGCGGATCCTGTTCTTCCACTACTCGTCCCGA
CAGCAGTTCGATATTCGTGACAGACCAGGAGCCGATGCTGTCTCTGATGAAGCACAACATTGCGCTAAATGGATTACAAG
ACAGAGCCCGGGCAGTGGTGTTGAACTGGTAGGTTTCTTTTGTTTTGTTTTCAATTTATTCTTCTTTCTTTCCATTTCAC
TCTTTCCTCTTCATCTTCTCGCTTTCTCGCTCCTACCCTAACCAACCAGGGGCGATGTTCTCCCAGAAGAGGTGCGCGCG
CTGCGTCCAAACGTCGTGCTGGCAGCCGACTGCATCTACTTTGAGCCGGCCTTTCCGCTGCTGATGGCCACGCTGGAGGA
GCTGCTGCAACTAGGCGAAGCCGGCGAGCCGGTCACCGTCTACTTCAGCTTCAAGAAGCGCCGGCGCGCCGACATGCAGT
TTGTCAAGAAGGCACAGAAGCGCTTCTGCGTCACCGATCTGGCCGACGAGGACCGGCCGGTGTTCAGCCGGCAGGGCCTG
TTCCTCTACTCCATCACGCGCAAGGGCCAACAGAGAGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62