GenePrediction:GLEAN_730 Details

Name: GLEAN_730
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1705935..1707972 (+ strand)
Length: 2038
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1705935..1706697 (+ strand)
Length: 763
Type: CDS
Source: GLEAN
Position: GCSC_97:1706767..1706830 (+ strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_97:1706893..1706983 (+ strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_97:1707047..1707136 (+ strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_97:1707199..1707290 (+ strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_97:1707351..1707611 (+ strand)
Length: 261
Type: CDS
Source: GLEAN
Position: GCSC_97:1707828..1707972 (+ strand)
Length: 145
>GLEAN_730 class=GenePrediction position=GCSC_97:1705935..1707972 (+ strand)
ATGGCAGTTTTTCAACAGCAGCCCGCGGAGAATGGCGGCCATGCACGCCGTGGAAGAAACACCCCTATTTTTGTCGGCAA
CTCTGATGCTGCTCTTCACCATCAGGGAGCAACTGGTACTCCCGCTCATTTGCAGGAAGATGGCCTTGGCGGCCTCATGA
CCCAATTCCGCGCAATGGGACTCGCCAATGGCAACATGGCTCCTGCTGGTCCGGCCATGCATGGCATCAATCCCGGCACC
TTTGTCACTGGTGCTGACGGCAGCATTCTTTTTGCTGCACCGTATGCTGGCCCGCTTCACCCAATTCTTGCTGAGCATCA
TGCATATGGGACGGCTGCATACCCCATCCAATATTCCGCCGGCGGGTACCCTGCTGCATATGCCACGGGCTCAATGATTC
CCCTCACTCCGGGACGTCCAATGGCCTATGGTGATCGTGTCCCGCGCGATCTTCCCATCTTGGAGAATCGCCGAAGCTCA
TACTCGACCTCTGCAACCGAGTCCACTCCGACCACGCCGTATTTTGGTCATATTTCTGACCGCAACGGTGGCACTCGAGT
CGCGTCGCTTGAGCGGTCGTCATTCACGACGCCATCTCCTCGTGATACAACCACATATGTTCCCGGCAATCAGGCCAAGA
TTGCCATCGATCCTGAAATTGAGCGTCTGCTCGCCGTGGACCCACCAGTTCCCAAGGCGGTCCCCGCGGTTTGGACCGAC
CACGTCAAGCCTATGGAACAGTGCCTTAAGAACCGCATTCAGGGTAATAGGAATGTTTACATTCGTGGACTTCATCCTAC
GACTGACGATGAACTTCTTCTGCGATATGCAGAACGCTTTGGAGAGGTCGAGCAGTCGAAGGCCATCATTGACACAGCCA
CTGGTGCTTGCAAGGGGTAAGCTTATCTGACCTTTGTACCGTTCTTATGTGCACACTTTATTTCTAACCATTCATTAGAT
TTGGTTTTGCCAAGTTCCGTGATGTGAAGAATTCCGAGAAGTGCATTCGTGGCTTTTATCGTCTTGGATATGAGGTTGGT
TTTGCCAGAGTGAGTTAACCATCTTTGCTTTCCTTTATACGGTATAGCTTTCTGATCACTTTCTCTACTCAGGAAAGTTT
CAATGCTCGCCTGAAAGCAGAGGGTGATGAGTCTTCGACCAACCTGTATATCTCGAACCTGCCGAAAGACATCAACGAAG
CCGTCAGTACAGCCTGTATTTTGTACCATTATTCCCACTTTCTCATGCTCATTCATATATCTAGATGTTGAATCACATTT
TCGAGCCTTTCCATGTTGTCTCCAGCAAGATTCTCCGCGATTCCATGGGAAACAGCCGTGGTGTTGGCTTTGCGCGGTAT
GATCACAGCCAATATTTTATCTCTTCCGTCCCATTTTCTAACCATGTCGGATACAGATTCGATACTCGCGACATTTGTGA
GAAAGTGATCAAGCATTTCAACGGCATCACAGTCGGCCAAGACCACTTCGTCATGCAAGTCCGCTATGCCGACACACCTT
CGCAAAAAGAGCTCAAGCGAATCACTGCCGAGCGCCGCCAATACCGCACGAATGAATACAACATTGGCGCCTATGGCACA
CACGCGGTCGGGATGAACCCTTCTATCTACGGGCCTGCTGTATGGAACCGCCGTCCTCAGGGAAGCACTGGACACAGGTA
CAGTATCTACTCGTCCAGCCGAGGTGTCGTTTGCTCAGTCTCAATAAGCGCAAAGCTGACTGAGATTAATATCTTTTATA
GCCATGGTCCTTTCCGGTCGGCTTTCCGCCCGCGCAAAACTCACTCTTCTGATCGCAATTCTACTCGCAGCCACCAGTAT
GGCTTTCGGCGGTTTCAGTCGCAATAGGATTTTACTAACAGAATAATTAATAGACAGGAAGAAGTCAATGACGTACACTC
TGCCTCTTCCGAGGAGGGCTCGGCAGACGAGGGTGCTACAGTCATTGAACCTTCGATTGCAGGATCCGAATTTTGTGGCT
CACCAAAGCCTTCTTCTGTTGAAGCAATTGATGTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62