GenePrediction:GLEAN_7312 Details

Name: GLEAN_7312
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2828613..2827682 (- strand)
Length: 932
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2828613..2828167 (- strand)
Length: 447
Type: CDS
Source: GLEAN
Position: GCSC_140:2827804..2827682 (- strand)
Length: 123
>GLEAN_7312 class=GenePrediction position=GCSC_140:2828613..2827682 (- strand)
ATGGAGCAGGACATGGGAGGAGAGGCGGAGACGTACTACGGCGGTGAGTTCGACGATCTGGCGTTCGTCGAAGAGCTCGC
GCAGCCGGGCAAAGGTAGCGTCGGCGACGGTGACGCTGCGGGTCATCTCGTCCGTGTAGACGAGCACGGCCCACTGGGTC
TCGGAGAGGGGAGCGGGCTGGCCGGCGGGCGTTGCAAGCAGCTCATCGTGGCGGTCGAGCGAGAGGGGGCCATCGAGCTT
GGCCACGTCGAGGCCGGCGGCCGAGACGCCGGCCTGAGCGGCCAGCGGGGCGTGGTGGCCCCATTCGTACCAGGCATGGT
TGACGACGGCGACGCGACTTACGGCGAGCTCGCGCAGGTCAGCTGCCAGAGCCGTCGTCTTCGTGCGCACCGCCCCCAGA
AAGGCGTTCCAGCCATCGGCGACGGCGGGCGCGTGCAGCAGCGCCAGGTCCAGCGGTTGCAGCGGCCGCGGCGCCCGGCG
GGCAGCAATGCGGGCCACAATGGCCGCGTCCTCGGCCGTCGTCGGCTCGGGCGGGTTGGGCACGTAGGGAATCCGCATCG
TCGGTGTTGTGAGAAGATGACGACGAGAAGATGAGAGGATGAAGCGAGGTGGAGAATCTGACGAGAATGCTAAAGGAAAG
CTCCGAAAGACCAAAATGAAACGAAATGACCCTGGGCAGCCCTAAAGGAAATCCAATCGAACCTGAATGCACTCGGACAA
TCCCGATTCAACCCGAATCACCTTCTGAAAGCCTGAAGATGAGGCCAAACAACCCCTCCGGGAGCTATAAATCTGGGGAA
AAACTCTAGCCCGCCGCACTTGCCGAAGCTCCTCCGCCGATCTTCGGCTATCTTTGCGGCGGTCGCGCCTTCCCCGCTAA
CGCCTTGAAAGAATACCGTCTAGCAGTAGTCAGCAGCATTGAGAACAAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62