GenePrediction:GLEAN_7315 Details

Name: GLEAN_7315
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2799121..2798356 (- strand)
Length: 766
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2799121..2798815 (- strand)
Length: 307
Type: CDS
Source: GLEAN
Position: GCSC_140:2798756..2798571 (- strand)
Length: 186
Type: CDS
Source: GLEAN
Position: GCSC_140:2798504..2798356 (- strand)
Length: 149
>GLEAN_7315 class=GenePrediction position=GCSC_140:2799121..2798356 (- strand)
ATGATATTGCGAACTTCGCCATCCAAGGCGAGACCGCCCGTGCTCTCATTTCGCACGCCGCCGCGACGGACATTTCACTC
GTCCAAGACGCGTTCGCAAACACAATCGCAGTCGGCCAAGGGCGAGGCTGCCGGTAAGGGTGCTGGTTCCGGCCCCGCCG
CTGCCGAGTCTCTGAGTCTTAGTGCGCGGCTGAAGAAGCTGTCACGAGAGTATGGATGGGCGGCCGTTGGTGTCTACTTC
GGGCTGTCTCTGCTCGACTTCCCGTTTTGCTTTCTGCTTGTCCGGACTGTGGGCACCGACAAGATTGGTAGGCCAACTCG
AACGGAGGAAGCGATCGGCGTGAAACAGACGCTAACATAGCACAGCCGAGATCGAGCATGTTGTGGTGAACTATGCGAAG
GCGGTCATCCCAGAGAATGTCAAGGAGTTTTGGCGCAACTACAAGTCCAACCTGAAGAAGGTGGAGAAAGAGAGCGGCAA
CGCTTCGGGTGAAGAGGATACCGAAGGCTGGGGTGTTGAGGAGGCTGAAGAGCGGCACAAGCGCTCAGCTAGTACGTGAC
TGTCTCTTGATTAAACACCAATCAACAGCCTGATGCTAACGAGTATCTTCTTCTCAGGCCTTGCTACACAATTGGCACTC
GCATATGCCATACACAAGAGCTTCATATTTGTGCGCGTGCCTCTGACAGCTGCAGTCACGCCAAAGGTGGTCAAGATTTT
TCGCAGCTGGGGGTGGAAGATAGGGAAAGCGACCCCGGGAAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62