GenePrediction:GLEAN_7316 Details

Name: GLEAN_7316
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2797382..2795166 (- strand)
Length: 2217
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2797382..2796980 (- strand)
Length: 403
Type: CDS
Source: GLEAN
Position: GCSC_140:2796913..2795166 (- strand)
Length: 1748
>GLEAN_7316 class=GenePrediction position=GCSC_140:2797382..2795166 (- strand)
ATGGAGGAAACGGCAGAGCCTTTGATCGAAAAGAGGCAGAAAGGGATATCTGAGGCTTTTTACAGAGAAGCACCATCTGA
TCCAGGGCGACCGTCGAGAACAAGGTGGCTGCTGTGTCTTTTGCTCCCATTAGTGTTGGGCTCAGGTCTCATCTTGGTGG
TCACCTCGCGAGTTTTTACTTCCTGCCAGCCACCTCAGTCTACGACACTGGACACAGAATCGAGCGACACTCATGGAAAC
GGTTTATATGAGCGCGGTGTTGCCGCCACCTCTGCAACATCTGCGGCAGTGCTTGAAAACTTCCAGGTTGCGCAACCCGT
CTTGACGCCAGAAGGGGCTACCTCATGCTCAGTGGTACTGATGGATCACGTTTTTGGGTACAGCTATGGCGTACCGTTTG
TTGGTGCGTTGAGCTGAATCAGGACAACCGAGAGCGACTGCTAACGCGCTGCACTTCTCTGCATCACAGGGGAATACACA
CCGCCCAGTTGCCAGTTCAACCGGGTCGTGATGAACTTCACCGTCACGTCCGAGGGCCGGCAGTTTGACCGGCTAGCACT
GATGTACCTTAACGACACGGAAGTGTGGCGGACCAGCACTGCTGAGCCGGTTGCGGCTCCTGGAATCCAATGGGTATATA
ACAAGGACATGACCGAGTACCTGTCGTTGTGGAGGTCGCCACAGAAGATCATCTTCGATCTCGGCAACATCGTCAACGAC
AAGTACACCGGCTCGTTCAACACAACCCTGACAGCAACCTTTTTCATGTCAGACGTGGATACCGGTGGTGCTTCGCCGAG
CGATCTGATCATCCCTATCTCTGCGCGGAAGAGCGCGTCTAATGAGCCCAGTCTGTTCAGCCTGCCATCCGACAACGCCA
CCAACACGGTCAGCTTTCCCCGCAACGCCAACCGGGCCGTCTTCTCAGTGTCAGCCAACGGCCAGGCCGACGAGGAGTTC
TGGTGGAGCAACGTGCTGCAGAGTGACGTCCTGGCCTTTGAAGCCACGGTTGGCCAGTTCACCGGCTACAGTCCGTTCCG
CGAGGTGCAGGTCTACATTGACGGCCAGCTAGCCGGGGTGCAGTGGCCATTTCCGGTCGTCTTCACTGGCGGTGTGGTGC
CCGGGCTACACCGACCGATCGTAGGCATCGATGTCTTTGACCTGCGTGAGCATGAGATCGACATCACGCCGTGGCTGCCT
GTTCTCTGCGACGGCAATCAACACACATTCGCCATCGCAGTGGCAGGACTGTCTGATGACGGTCAGACAGCTGCATCCCT
GACGAAGACGGTCGCCTCCAGCTGGTATGTGACCGGGAAGATCTTTGTCTGGCTGGACGACGACGCCGACTCCGTCACCA
CCGGCAGCGCACCGGCCGTGAGCCTGCAGGCGCCGGTCATTCACGTGTCCCAGGACGTTCTCACAAACGCGACAGGCGCC
AACGAGACGCTGCAGTACACGGTATCGGTGTCGCGCGCGTTCAGTGTCCACGGCCGGGTGCAGTCGGAGAAGTCGTCGGG
CGCGGCGACATGGTCGCAGGCCTTGTCGTTCTGGAGTCTGGGCGTGGTATCGGACTATGGCTACGACCAGGTCAACACCT
TTAGCATCCGCGGCGATGACACGGCGGTTGTAGGCGGCAAGACCATCTACCGAGCCGGCTACCACTATCCCATCACCTGC
AACACGACGACGAACTATTCCGAGATGGGAAACCTGACGCTGTGGGCCGATCTGGACCAGGGACTGGAGCTGCAGGTCGT
CGGCGCAGCCGTGTTTCCCACCGGGCTGGAGGCCTTTGCAGCGACGACAGGGAAGAGCTTCTCGGGCGGTTCCGTCTTGA
GTACCCACTTCAACGGTACTGCGCTGTACTCCCAATACGGCGACGGGTCAAAGGCGACTGGCTACGGATCGACGAGCCAG
GTGTTTAGCTTTGGCGGCCGGACGGACTCGACGGCCGACGTCCCGCTCTACAGCCGCAGCGTAGAGGCTGTCAACTCGAC
AGTCGTGTTGGACCAGGAGTTTGTCGCGGGCGGCCAGTCGGTGACAATTGTCGACACTGTCCCATCTGGCTGGGCTTCGG
GGGCCAAGGAGAGCTATGCACAGGCGCCGCTGAGCGGCGGCACCGGTACGCGTGTGTTCATGGGACGCGGCGGTGCTGAT
CCGGCGGTGGCTGTGACTGCCAAGAGAGAGGCCGTGTTGAGTCTTGATGCGGAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62