GenePrediction:GLEAN_7317 Details

Name: GLEAN_7317
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2793281..2790516 (- strand)
Length: 2766
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2793281..2793190 (- strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_140:2793126..2793099 (- strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_140:2793047..2790791 (- strand)
Length: 2257
Type: CDS
Source: GLEAN
Position: GCSC_140:2790730..2790516 (- strand)
Length: 215
>GLEAN_7317 class=GenePrediction position=GCSC_140:2793281..2790516 (- strand)
ATGTCCGACGAGAAAGACGAAGGCAGCTCTGGCTTTATGGACAAGCTCAAGGAAAAGCTGGACAAAACCCACATCCATCT
AACCCACAAGAAGTCAGCCTCACCCTTCCCATATGCATGTCATTGGGATATATGGCTAACCATCTTGCTACACAGACATC
AGATCGGCAAACTTGCGAACTTGGTGAGCTGAGAACCTCCCCTCTTGTTTACCGGCATAGCGCTGACTTCCTAGGTCAAC
ATCAATCACCGACACGACGAGGAACATGAGAAGCAATGTGATGCCAAGCGCACCGAGATCTGCGAGTCTCATCGCTTCCA
GTCCTACTTCCCGGAGCAGGAAGGCAACCTCATCAAGTGGTACGTCGACGGGCGGGACTACTTTTGGGCGGTGTCGGCCG
CGCTTGACAAGGCACGTGAAACCATATACATTGCCGATTGGTGGCTGTCGCCCGAGTTGTTTCTGCGACGGCCGCCGTAC
TTTAACCAGGAGTGGCGCCTGGACCAAGTGCTCAAGCGTCGCGCCGAGGCCGGTGTTAAGATTTTTGTCATCGTCTACCG
TGAAGTGGAGGCGGCCTTGACGTGCAATTCGGAGCACACCAAGCATGCATTGCAGGCTCTGTGCCCAGAGGGCAGCCCCG
GTCATGGCAACATCCGGATCATGCGGCACCCGGACCACAATGTGTTTGAAAACGCGGCGGACATGACGTTCTACTGGGCG
CACCACGAGAAGTTCATCGTGATCGACTACGAGACAGCCTTCATCGGTGGGCTGGACATGTGCTTTGGGCGATGGGACAG
TCACACGCACGCATTGGCGGATGTGCACCCGGAGAGCGTGGCCCATGAGGTGTGGCCCGGGCAGGACTTCAACAACAACC
GGGTCAAGGATTTCCAGAACGTGAAGGACTGGAAGCAAAACGAACTGAGCAAGGCGGAGTTCGGCCGTATGCCGTGGCAC
GATGTGGCGATGGGCGTCGTGGGGCCATGTGTCTACGACATTGCAGAGCACTTTGTGCTACGCTGGAACTTCATCAAGCG
TGACAAATACAAGCGCGACAAGCGTTTCGACTGGATCATGCTGCGTGGCCGCGAGGGAGAGGACGAAGCCCTTGTCGGCG
TGCAGCGGCCAGACCACCCGGTGGGCGACTACGTTCTGCACCCGCTGACGCCGCTGGAGAGCAAGCCGCAGCTGCGGCCG
GACAACGGCACCATGCGTGGCCAGCTGGTGCGGTCGGCCGACGACTGGTCCAACGGCACGCTGGTCGAGCACTCGATCCA
AAACGCCTACAGCGAGCTGATCCGCAACGCCGAACACTATGTGTACATTGAAAACCAGTTCTTCATCACCGCCACCGGTA
CCGAGCAGTCACCGGTCCACAACACCATCGGCTCTGCTATTGTCGATGCCGTGGTGCGCAACTCGGAGCGCGGGAAGAAG
AACTTCCGCGTCATCATCCTCATCCCGGCCGTGCCCGGCTTTGCCGGCGACCTGCGCGAGGATGCCGCCCTGGGTACGCG
CGCCATTATGGACTACCAATACAAGAGCATCTGCCGCGGCCCCAACTCCATTTTTGAGCAGATCCGTGCCAAGGGCGTCG
ATCCGACAAAGCACATCTTCCTTTTCAACCTGCGGAGCTACGACCGTCTGGCGAACACGGCGGCCATGAAGCAGACTGAA
GAGGAATCGGGCGTGTCGTACCAGGAGGTGCAGCGTGCGGAGGCAGAACAGATCATGGGCGAGGGCATCCACGGGACCAT
TGACAACGATGGCGGACGCGACACGCACATGGGCCGGGCAGGCAACCAACAAAGGACCAAGGACAAGGCACAGGAGAGAT
CCGATTTTGAGAACGACAGCCGAAAGCCAGACTACATGGAGGAGGCCACAGATAAGAAGCGCAAGTTCGAGGCAGCGCAG
GAGGGAGGGGACGGGGAAGGCAAGTCATCGGCAGCATCGGCCAGCTTGGCGAAACACATGATGGCCGGCGAGGGTCCGTT
GTCGGAGGAGCCCTGGGACGGCGAGGCGACGGATGAGGTGCAGAACTGGATCCAAGAGGAGCTGTACATCCACGCGAAAC
TGCTGATCGTCGACGACCGATTTGTCGTGTGTGGCAGCAGCAATCTCAACGACCGAAGCCAGCTAGGCAGCCATGACAGC
GAGCTCAGCATCGTGATGGAGGACACGCGCATGCTATCGTCACGCATGGACGGTGAGCCCTACGAGGCCGGCTACCACGC
CGCCACGCTGCGCCGCTTCCTCTGGCGTGAACATCTGGGTCTGCTGCCTGCACAGGGCCTCGACGGCTCGGACGATCCCA
ACGCCCAGCCGCCGTCGACTGATTCGCCCAACGACGTGCACGACCAGGACGACAGCTGGGCCTTTGTCGAGGACCCGCTG
AGCGACGAGCTGTGGAACATGTGGACATCGCAGGCCTCCACAAACACGGAAATCTACCGACACCTGTTCCACGCCGATCC
AGACGATAACGGTGGGTATTTTGATGTCTTCTTGCCCCTCCCCATGCTCAACATCCTGCTGACAGAAACAGTCAAGACAT
TCGACGACTACGACCGCTTCCTGCCGCCAAAGGGCGTCCGCGCCGGCCACATATTCGACCAGTTCATCCCGCCGGAGGAT
ATCCGATCCAAGCTGGACCAGATCAAAGGCCACCTGGTTTGGATGCCGCTGGAGTTCCTAACCGACGCAGCCATGGCCGA
ATCGGGACTGCAGGTAAACCAGTGGACCGAGAGCGTCTACGCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62