GenePrediction:GLEAN_7318 Details

Name: GLEAN_7318
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2790099..2789301 (- strand)
Length: 799
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2790099..2789949 (- strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_140:2789889..2789831 (- strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_140:2789767..2789649 (- strand)
Length: 119
Type: CDS
Source: GLEAN
Position: GCSC_140:2789595..2789301 (- strand)
Length: 295
>GLEAN_7318 class=GenePrediction position=GCSC_140:2790099..2789301 (- strand)
ATGGCAACCACTGCAGTAATCCCGGCCGATGGCACCTTCCTCGACACCTTCAGCAAGTCCTTTGTGGATGTGCCGGTGGA
TGCGGCCAACGACAATGCTATCGACACGACGACCTTCCTCGAGGCAGCTGAGTCGCTGACGACCATGTTTGGTGCGTGGG
AAGACGAACCGCTGAAGAAGGGATGAATACAGACTAACATGCGGGACTAGACATGCTCGGCTCCGTTGCTTTCTCGCCTG
TCAAGACCGACATGCTGGGCAACATCAAAGTAAAAGCTTCAGAGGGGCCAATTGACAGTTCCAAAGAGTGGACATGAGAC
TAACGGCTGTAGAAAATCCGGGAACGCCAGCTGGCCGCCCCCGGCGAGTCCGCCACGCTGCAGGCGCTCGTGATCAACGA
GCTCAAGACCAAGAAGCACGTCGCTGCTGAGGGTCTGTTGTGGCTTGTCCGGTATGTTTTTTGTCTGTCCGGACAGATAC
CCGTTCCCTGGCTAACCCTGTCAGCGGCCTGGACTTTACGTACCAGGCGCTCTCGAAGAACGTGGCTGCGGAGTCCGAGG
AGCTCGCCGACTCGTTCCGCAACGCCTACGGCAACACGCTCAAGCCATTCCACAACTTCTTGATAAAGCCCGTCTTTGCT
GCCGCGATGAGCGCTTGCCCGTACCGTAAGGATTTCTACGCCAAGCTGTCGACGAACCAGGCACTGCTGCAGGAGAAGCT
CCGGGAGTACCTGGCGGCGCTGGGCAACATTGTCGAGATCCTCAAGGCCTTTGTCACCAGCAAGGCAGCCAAGTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62