GenePrediction:GLEAN_731 Details

Name: GLEAN_731
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1710463..1713395 (+ strand)
Length: 2933
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1710463..1710598 (+ strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_97:1710690..1710757 (+ strand)
Length: 68
Type: CDS
Source: GLEAN
Position: GCSC_97:1710832..1713303 (+ strand)
Length: 2472
Type: CDS
Source: GLEAN
Position: GCSC_97:1713366..1713395 (+ strand)
Length: 30
>GLEAN_731 class=GenePrediction position=GCSC_97:1710463..1713395 (+ strand)
ATGGCGCAAGACAACGATGTGTCCAAGGCCGGCGACAAGGGCAAGGCCAAAGCTGTTGACAGCAAGAGCCAAGAGGTCCC
TAAAGACAAGGATACCAAGCCGGTCACGAATGGAAAGAAGGACGAGAAGGACGACTGTAAGAGAATTGCCTTCACTTCTG
TTGTGCTGTATATGTATGACGCATTTGCGTTGTGTCAAATGCTGAACTGACGGTCTGTCCCTTCCAGCCGAAGAGCTGAG
CGAAGAGGACCAGCAGCTGAAAAGTGAACTGGAGATGCTCGTGGAGAGACTGACGGTAAGTGAGGTTAAGAGGTTGCGGC
TACTAAGCAAAGAATCGGCGCTGATAATGGGCCACAACACATGGAACAGGAATCGGACACGACTCTCTACAAGCCGGCGC
TGGAGGCGATGAAGAACTTCATCAAGACGTCAACGTCTTCGATGACAGCAGTACCTAAGCCGCTCAAGTTTCTCCGGCCA
CACTACGAAACGATGACGAAGCTGCATGACGAATGGCCGACAGGCAATGACAAGACGTCGTTGGCCGACGTGCTGTCTGT
GATCGGCATGACGTATTCAGACGAGGGCCGCCAGGACACGCTCAAATACCGACTTCTGGCGCCCACGCAAGACATTGGGT
CATGGGGTCATGAGTACGTGCGACACCTTGCGCTTGAGATTGGTGAGGTGTACGGCAAGCGGATAACGGCAGAAGAAGCG
ACGACGGACCTCGTAGATCTGGCGCTGGTTCTGGTGCCCCTCTTTCTGAAGAGCAATGCGGAGGCAGATGCGGTTGATCT
GATGAGCGAGATGGAGATCATCGAGAAGCTGCCCGAGTTTGTGGACCAGGACACGTATGCACGTGTGTGTCTGTACATGG
TGTCGATGGTCAACCTCCTGACGTACCCGGACAACGAGCAGTTCCTGCGTGTTGCGCACGACATATACAAGGAGTATAAG
CAGTACACGCAGGCGATGGTTCTTGCGATCCGGCTGAACGACATGGACCTGATCAAGCTGGACTTTGAGCAGACGGAGGA
CGCGGCTCTGAAGAAGCAGCTGGCGTTCCTGATTGCGCGGCAGCGGATCTGCCTGGATACGGCAGACATGGAGGACCAGG
AGCTTGTGGAGTGCCTGTCCAACGTGCGGCTGTCGGAGCACTTCAAGCTGCTGGGCAAGGAGCTCAACATTCTGGATCCG
AAGACGACGGAAGACATCTACAAGAGCCATCTGGAGAGCAGCCGGGTGTCGAACATGACGAACATCGACTCGGCACGACA
CAACCTGGCGGCGGCATTTGTGAACGCGTTTGTAAACGCCGGGTTCGGCAAAGACAACATGATGTTGGTGGAGCAGGACA
AGGAGAGCTGGGTGTGGAAGACCAAGGACGAGGGCATGACGTCGACGGTGGCGTCGCTGGGGACGCTGATGCTGTGGGAC
ATTGAGAACGGGCTGGACAAGATCGACAAGTACACGTACGTGGAGGAGGAGCAGATTCAGGCGGGTGCCATGCTTGGTAT
CGGCATCATGAGCTCGGGCGTGCATCTGGACTCGGAGCCGGCGTTTGCGCTGCTGAGCGACCCGGAGAAGCTGGAGCACA
AGAACCCGCTGATCCGAATGTCGTGTATCATGGGGCTCGGGCTGGCGTACGCGGGCTCGCACAACGACATGCTGCTGGAC
CGGCTGCTGCCGATCATCACGGACACGTCCAACGACATGCAGACGTCTGCAATGGCAGCGCTGGCGTGCGGGCTGATCTT
TGTGGGATCGTCGCACGCGGACACGAGCGAGGCCATCATCACGACGCTGCTGGACGACGACCGCAAGCCGCAGCTGACGG
ACAAATGGACACGGTTCCTGGGCCTGGGCCTGGGGCTGCTCTTCTTTGGGCGGCAGGAGGAGGTGGACGTGATCCTGGAG
ACGCTCAAGGCGGTGGACCACCCGGTGGCCAAGCCGATGGCAGTGCTGGCGACGGTGTGTGCATGGGCAGGCACGGGAGC
GGTGCTGAAGATCCAGGAGCTGCTGCACATGTGCAACGAGCACCTGGAGGAGTCGGAGGACAAGAAGGGCGACGAGCTGC
TGCAGGCGTATGCGGTTCTGGGCATCGGTCTGATTGCGATGGGCGAGGACGTGGGCCAGGAGATGGTGCTGCGGCACTTT
GGACACCTGATGCACTACGGCGAGCCCAACATCCGGCGAGCGGTGCCGCTGGCAATGGGGCTGATCAGCCCGAGCAACCC
GCAGATGAAGGTGTATGACACGCTGTCGCGATACTCGCACGACAACGACAGCGACGTGGCGATGAGTGCCATCTTTGCGA
TGGGACTCTTGGGCGCAGGCACGAACAATGCGCGTTTGGCGCAGCTGCTGCGACAGCTGGCGAGCTACTACCATCGCGAC
CAGGAGGCGCTCTTCATGGTACGGATTGCTCAGGGGCTGCTGCACATGGGCAAGGGCACGCTCTCGTTGAGTCCGTTCCA
CACGGACCGGCAGATCCTATCGCGGGTCTCGGCAGCGGGCCTGCTGGCGGTGCTGGTGGCCATGCTTGATGCGAAGCAGT
TTATCACGTCGCACTCGCACTACCTGCTCTACTTTCTCGTCACGGCGATGCACCCGCGCTTCCTCGTCACGCTGGACGAG
GACCTCAAGCCGGTCACGGTCAACGTGCGGGTCGGTCAGGCCGTCGATGTGGTTGGCCAGGCCGGTCGGCCGAAGACGAT
TACCGGCTGGCAGACCCAGAGCACGCCGGTGCTGCTGGCGTACGGCGAGCGAGCCGAGCTCGAGGACGAGGAGTACATCA
GCCTGAGCAACACTCTCGAGGGATTGGTGATTCTAAGAAAGGTGCGTTTGGGGGTTTTATCATGAGTATTATTTGAATTC
TGTGGCCTCTGCTAACAGCACAGAACCCTGAGTGGGACAGCGAAAACAAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62