GenePrediction:GLEAN_7320 Details

Name: GLEAN_7320
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2778015..2774677 (- strand)
Length: 3339
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2778015..2777842 (- strand)
Length: 174
Type: CDS
Source: GLEAN
Position: GCSC_140:2777782..2776708 (- strand)
Length: 1075
Type: CDS
Source: GLEAN
Position: GCSC_140:2775980..2774677 (- strand)
Length: 1304
>GLEAN_7320 class=GenePrediction position=GCSC_140:2778015..2774677 (- strand)
ATGGGAATGATTACAGGCATGTACTGGGTGCAGATATGGACAGCCGTTGCAGTGGTGCTGCAGGAGACAGCAGTGGCTGA
AGGCCCGCAGAGCTGTTCGCACGAGGCCAACCGGGTGTCCTTGGCCACTGCTCCTCCGATATGCGCAGCGTCGGAACCAG
CAGCTCTCATCCCTGTAAGTCGGACAGGCCTCCAGCAGGTGTTAAACAGAGCATGTTACTGACGGGGAAACAGGCACTGC
AGCAGACATGCAGCCGTGACCATGAGAGCATTGGTGTGCCAGGCTACCGGCCAGCAGAGGCACACGGGTTGTGGGAGGTG
CGGCCGTCGCCAGGAAAAGGCCGCGGCATGTTTGCGGTGGTGGACATTGTGCGGGGGACGCGTCTGCTGGAGGAGCAACC
GCTATTTGTGGTCTCGCCACCGCCGTTGGTTCCGGGTGTTGGGTTCTCGCTGTCGAGCATGCAGCCTGTGGTGGAGGAAG
CGTTTGCAGGACTCAGCACGGCCCAGCAGGTCGAGTTTCGTTCTTTGCACGAGGTGCAGCTGGCAGGAGAAGAGAGTGAG
GGAAGGAGAAGCGAGGATGAAGAGGGAAACAAGCGCAGCGAGGAAGAAAAAGAAACACACGGCCGCAGACTGATGCGGAT
TCTGCGCAGCAACGGCTACAACACGCAGGACGGCCGCGTGGCCATCTACCCCAAAGCGGCGCTGGTAAACCACGATTGCC
GGCCGAACGTGTTCAACACGGATGTGGCTGGCCGCCGGGTGATCATGGCGACGCGCGACATTGCCGTCGGTGAGGAGTTG
CTGACGACGTACGTGCCGCTGCTAGCCGACACGACGACACGGCAAAGACGGCTGATTCAGTACGGCTTCCACTGCAGCTG
TGTGGCCTGTCTGGCGGGCGAGAGGGATGGAGCTGGCGACGGGACAGACGACGGCCACCGCATCTACATGGGAGCTGTTC
TAGACGACTTGGAGGCTGCAGTACGCGAAGAGGCAGCAGCAGCCGATGACGAACGGAAGAAGCAGACGCAAAAGCAGAAG
CAGAAGAAACAGAAGCGGGTGCAGCAACTGGCTCGCAATGCTGCCGAGCTGGCGGCCTATGTCGAGACGCAGGGCTTCGC
CGACTACTACGTGCGCACCAGCCGGCTGGCCGTGGAGTTTTCCTTCCGGGCGGACGACGGCATGGCGGCAAGGCACTGGG
CACAGCGCCATCTGGAGCATCACCGGCTGATAGACGAGACGATGCAGGCGACACACGATGCCCACGCGCTTCTCGGCTTT
GTCGAGCAGGCAGTGCAAGGCCAGCAAAGTGAGAACAAACGCTGATTGGGAGAGTATGGCCAGGTGGCCTTGCAGAGAAG
AAGTCGACAATTAAGCTACATGTGTGCTTTGAGATCCTGGCTGTGCTGAGTGGGATTATGTGAACTTTGCGTGATGGAGT
CGATGCTGTTATTTAGACTTTGTTTTTAGCTCTCACACGACCTGCACTGTTGGCCCGATAGCTCCAAAGTTAGGCCTAGC
ACGGGCCAACAGTCGCCCGCACAGCCGCTGTCAAATTAGGAGTGCCCCTGTGTGTTGTAGGCAGGTACGGGGTACTTCCA
AGCTATGCCAACGTGCACGAAATCTGTAGCTAAATTGGGCCGTGCGCCACACACTTCATGTATCGGCACAAGTCTTCACG
CCCCACCCTTTCAGGCCTAGTTCGTTCGACAGCTGCCAGAGCTGCACTGCCACCATGATCTCTATCTCGCCTGCAGGACG
GCCAAGCTGCAGACGGTGCAGTGAAACAGGGGAGAATCAGGAAGTAGTGCTTCGGAGTTATATATGTATTCGTCTTCTAT
TCTTTTTTTATTCCAACGGGATATACTCCATACCTCTCCATTCTTTCGCATTAACGAAACCGCCAGCCAACATGGACAAT
CGATCGATTGCTTCCCGCTGCAAGGAGCTTCTGCAGGTCAGTACAAGAACATCGAGGATCTCTGCTTCCCAGCAGGTTTC
TGAGTAGAACTCGCGAGCACTAACTCGCCGTCCAGTTCCTCTCGACCACCACGGGCGATCTCTCCAACGTGACCGGACCG
CCAGCCTTTTGCTGGCGCCTTCGTCCGTTGTCGAGGTTGGCCACTGTTGGGGCCAGCGACCGGCCGTGTTTGCCGCGCCC
GCGCTCGAGTCGAGTGCCGAGCGCCGCTGTTTGCTGGTGCTGCGCATGATGTTGATCGCCCTGCGCAGCCAGGTGTACGT
GGGCGGGTCGACCAAGACGAGCATCCGGAAGCCGCTCAACGCGTTTCTGGGCGAGCTCTTTCTGGCCGAGTGGACGAACG
AGAGGAGCAGCAGCAGCAGCAGCACCCCCTCCTCCTTCACAACACGACTTGTGGCCGAACAGGTCAGCCACCATCCGCCC
ATCACGGCCATGCACCTCGCCGACGAGACCCACGGCGTTCGAGCTGACGGCTACGCCCGTGTCGAGATGACCTTTGCCGG
CTCCGTGCAGGTACGCCAGGTCGGCCACGCCCTCGTGCACATCGACCGCTACGACGAGGACTACCTCTTGCCGCTGCCCG
ACGTGCGCGTGCGCGGCTTCCTGTCCGGCCGCCTGTACCCTGAGATCATCGGCACCTACCACATCGTCGCCAGCAGCGGC
TACACCGTCGAGCTGGTCTTCTCGGGGCAGGGCCTCGCCTGGGGCGGGACCAGGAACGCCTTCACTGCGCGGGTGATGGG
AAGGGAGGTGGGAGAAGAGCCGGAAGACGGAAAGAACGGGAAGAGCGGGAAAGAGAAGAAACCAAAGCACGCAAAGCACG
CCAAAAACACAAAGAACACAAACACAGCCCGGGAAACGCTCTACATCGTCGAGGGCGTCTGGAGCCAGGGCTGGACCACC
ACAGACGCGCGGACCGGCCAGGTGCTCGAGCGCTACGAGGTCGACGCCGTCGAAAACGCACCGGTCGCCATCCAGCTGTC
GCCGCCCGAAGCACAAGATCCGTGGGAGTCGCGTCGTGCCTGGGCACCTGTCATCGACGGCATCGTCCGCGGCGACCTCA
GCCACGTCGTGGCCGAAAAGTCTCGCATCGAACAGGCCCAACGCTGCATGCGCGCTCACGAGGCCAAAAACGGCACCATC
TGGAAGCCGCTGCTGTTTCGAAGCAGCAGCAGCAGTCACGACGACGCAGAAGCACCCTGCCCTAAAGCCACAGCCGCGCG
CGACACGTTCCACCGCCTCGCCGCCGGCCTCGACCTGCAACTGCACGACGAGCAGACCATGGGCGTGTGGCGCGTTGACG
AGACCAAGATTCAAAACCTGCAGCGACCGTTTCGGGGCGAGCTGACGCCATTGGGATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62