GenePrediction:GLEAN_7321 Details

Name: GLEAN_7321
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2773756..2771459 (- strand)
Length: 2298
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2773756..2773712 (- strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_140:2773582..2771928 (- strand)
Length: 1655
Type: CDS
Source: GLEAN
Position: GCSC_140:2771867..2771459 (- strand)
Length: 409
>GLEAN_7321 class=GenePrediction position=GCSC_140:2773756..2771459 (- strand)
ATGTGGGAAGTCACGAATGCGAATGGATCCATTGCTGCTGATCACGTCATCCCTGCAGCGGTGCTAAGTCTTCGGTCGGT
TCTCCGACGGTGTCCTCTCGGAGGACAGAGGTATACTTTGGATTTTTTCGACGCGAATCACGGTACACGCATCTGCTTTC
TGCTGTCGACATAGCTCCGACCTGTACTCGTCGTGTGCACGGTCTCTGCCGACTGTGTCGAGTCGATCCGGCCAGAAACG
AACGACACATGCGCCTGCAGCGAAAAGTCTCTCATCCGCGAGGAGGCTTCGGCTCACACACAGCCCTGGGCGATCATGAG
TCTCAACAGCGCTGGTGCTGGCGGCGGCAGTGGCGCCAGCAACAGCCATAAGCGCCAGTCCAAGTCATGCAAGCGCTGCC
TCAAGCGCAAGAAGCGATGCTACGGCTTTCCCATCTGCACCAACTGCGAGCGGGCCAACGAGCCGTGTGAGCAGTCGGCT
TTTGCCGTCCAGCTGCATCAGCGTGACGACAACTACGCTGCCATGCAGCGAATCCGCGCCCTCGAGGCCCAGCTCGAAAG
TGCCCATGCCGAGCTGGCCAGCATGCGTCGCAGCCAGCGTGCTCCGTCACCCGCCAGCAGCCGCCCGGCAAGCCACACGC
CCACAGAAGGACAGCCCAGTCGCAGCCAGACGGCCGAGCCATCTCCCAGTCCCGAGAGCATCGCAGACCGGCCGCCTCTC
CTCCCGCTGGAGCACATCGTTCAAGTATCCGTGTGGCGCAAGCTCTTGCCATCGGCCATTGATAAGACTCCGGAGCACAG
CGTTGACCTGCCGACAGACACGGCCGGCTTCGGCTTGGTCCAGGCCTACCTCGACCATGTCCACACACGATATCCCATCC
TGACACTGTCCGACCTGCTCCAGTTGCACGCACAGCGGCACGATATTGTCGACCCGGCCGGCTGGACCGATCCTGTTGCT
GAGCTCAACACTTTCCGACTGTATATGGTGTATGCTATTGGTGGTGCACAGCAGTACAAGGAGCAGCAGGTGTCCGAGGA
CTACTACGAGGCTGCGCTGCCACGCTTGTGGGCACTGCAACAGCTGCCACCTTTGGCCGGTGTCGAGGCGCTGTTGCTGC
TGCTGCTGTATGGCCTGCATTCTCGGCCGGTCAGCAGCACGGCAGTCTGGCAGGTCGCGGGACTGGCCATGCGGATATGC
GTTGACCTCGGCCTGCACCGAGAGGCATCGTATTCGAGCAGCCCAGACGAACAGAGCCGGACACGACGGCTGTTTTGGAC
CGCCTTCTGCCTCGACTATAGCGTCGCTCTGTGGCTGCGCCGGCCTTTAAGTCTGACGAGGCACGACATGGACACACGCC
CGCCGAGCCTGCAGGAAAACTCTGCAAATCTCACACGCGAGGAGGACACTGACCTGGTTGCGTGGGCCCGGTTTGTGCAG
CTTCGGCAGCTGGAGGCGCACATCTACACGGACATGTACGCGCTCGACGAGTCGCTCGAGATGCGCTTTAGTAAAGTGCA
CCCCTACCTAGAGGCTCTAGACGCGTGGATGCACGAGCTGCAGGCGCCTGCCACCTCTTCCACCAACAAGACTGCAACCG
TCAACGACGACTTCTGGCTGCAGTGGAACAAGGCGATTCTTGTGCTGCTGCGGCCGTTCCTTCTTGTCATGCACCCAGAC
GACGACAACGATCCCGACTCACTCGTCGCTCGATGTCTTCAGGCGGCCGGTCACGTCTGCTCGGCCGCCAAGCACATGCT
GCAACGCGGCCTGCACTCCCATGCGCTCGTGACTGCCCACGCAGCCTTTAATGCGGGCATCACCATCTGGTCAGTCCACA
GAAGCCACTCTCAAGCCATGCTGCCGCCATTCTTACTGATACTTCGCAGCTGCTGTCTCTACATCTCTCCTCGGCTGTGG
TCGTCCGCCGTTGTCAACGACCTGCGCGCCTGCTCGTCGACCATGTTGGCCATGGCAGAGCGCCTCCCACTTCTGAGAAA
CGACTGCTCTGTGCTCGAGGATGCCATCGGTGGGGTTATGGACTCGCTGTCAAGAACGACAACCGGACGTACCAGAAGCC
GACGGCAGGCACGGCACCTGGCCGAGCCGGACATCCTCGCCGTGCAAAGCCTGATGAAGCTGTCAGCACAACCAGACTTG
GTCACTGTGGCCACGGCCGAGCCACTGGACAATGCGTTGTCAGCACTGCAATTGCGCAGCCACAACCGCGATGCCGAAGA
CCAGGACCGCCTGCAGAATCTGATTGGGCTGATTACACCAGAATATCCGGCTTGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62