GenePrediction:GLEAN_7323 Details

Name: GLEAN_7323
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2757415..2755711 (- strand)
Length: 1705
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2757415..2757200 (- strand)
Length: 216
Type: CDS
Source: GLEAN
Position: GCSC_140:2757141..2756987 (- strand)
Length: 155
Type: CDS
Source: GLEAN
Position: GCSC_140:2756918..2756734 (- strand)
Length: 185
Type: CDS
Source: GLEAN
Position: GCSC_140:2756673..2756566 (- strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_140:2756500..2756291 (- strand)
Length: 210
Type: CDS
Source: GLEAN
Position: GCSC_140:2756234..2756135 (- strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_140:2756071..2755992 (- strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_140:2755928..2755711 (- strand)
Length: 218
>GLEAN_7323 class=GenePrediction position=GCSC_140:2757415..2755711 (- strand)
ATGACTCCGTTCAAGCCTTCAGCATTGGCCAGCGGGCCTTCACCGCTGGCCGTCGCATCTGCCCTTGTCGCCATGCTCGG
GTCAGTCTATGCAAAGCATCCACGGATGCTCGCCTCGTCGCCGACCGCCATCCCGTCTCAGGCTCAGGTCATCGACTCCA
AGAGCTTTGCCGTCCTGTCAAGCGTTCCCCCAGTGACGTCCAGCAATGGAAGTGCGGTACGTCTTGGCCTAGTCCGCCTC
ATGAGCTGAGAGAGCTTGCTGACCCCGTCTTCAGCCCTTTGTGCCACCTGGACACACCCTGGACTCTCTGCGCGCCCAGC
CGTTCCACGTCTACGATGACGCCTTTTACGACATTCTGGGCGCCAACCCGACCCTCTCGCTCGTCGCAGAGTCCGAGACG
GATCCTCTCTTCCACGAGGCCGTCATCTGGTACGCATCAGAAGGCCCGGTTTGAGACACATCGCCTTCCAGACGGCCCCC
TTGCTCATGCCTTTCAGGTTCCCCGACACCGAAGACATATTCTTCGTCCAGAACGCCGGCGCAAAGGCTGCCGGCACCGG
TTTGGCCAAGTCCAGCATCATCCAGAAGGTCTCTCTGGCTGCCGTCGAGAAGGCTGCAGCAGCTGGCACACTTGTCCAGG
TCGACACCGTCGACGCCTCGCCCCAGGTGCTCAACCCGAACGGTTTGTTTCTAACTGCTTCTGCTCCTCGTCCATACCCA
ATTCTGACACCCTCTTCTACAGGCGGCACAAACTACCGCGGCCAGCTGCTCTTTGCGGCCGAGGGCCAGGGAGACCAGCT
ACCGTCAGCCCTGTATCTCGTCAACCCGCGGCCGCCTTACAACTCCACAGGTGAGGGTGAAGATGCAACGAACACACAGA
AACTGCTTAGTCCGTGCTGACCTACGCCTCTCCAGTCCTCCTCAACAACTTCTTCGGCCGCCAGTTCAGCTCGCTCAACG
ACGTGGCCGTGCATCCGCTCAACCGCGACGTGTACTTTACCGACACGCTGTATGGCTACCTGCAGGACTTCCGACCGCCA
CCAGGCATGCGAAACCAGGTGTATCGCTTCAGTCCGGACACCGGCGCAGTCACCGTCGTCGCCGACGGGTTCAGCCTGCC
CAACGGTATGTGCAGCCCGGCTGTGTATTTCAAACCTGTCAGTCTGCTAACCGGCCGATAGGCTTTAACTTCTCCCCGGA
CGGTGCCTACGCCTATGTGACCGACAGCGGCCGAAATCGCGGCTTCACCGGGAACTATCATTTTTCTGAGCCGGCCACAA
TGTAGGTGGAGATAGAGACGTTGAAAAGACATGGCAGGCTGCTGAGAGGCTGACCGTGCTGCAGTTACCGCTTCAACGTG
AGCGCCGATGGCACCCTTGAGAATCGCAAGACTTTTGCCTATGCCGACACAGGCGTCCCGGACGGTGAGCCTCCTTGCAT
CCTGCTTCTGTGCCTCGTCTGATGCATGCTGACACCTAGCCTCACAGGCGTCCATGTCGACGAAAAAGGCAACGTTTATG
TCGGCTGTGGCGGCGGTGTTCAAGTCTGGAGTCCGTCCGGCACGCTGTTGGGAAAGATCTTCCTCGGTACAGGCGCCGCC
AACTTCCAGTTTGCCGGCAGTGGTCGCATGATCATATGCGCCGAGACGCAGCTGTACTATGCCACGCTGGCAGCCACGGG
GTCCTTTGTACAGTCTGAACTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62