GenePrediction:GLEAN_7324 Details

Name: GLEAN_7324
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2755341..2753937 (- strand)
Length: 1405
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2755341..2755279 (- strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_140:2755215..2755026 (- strand)
Length: 190
Type: CDS
Source: GLEAN
Position: GCSC_140:2754964..2754874 (- strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_140:2754802..2754399 (- strand)
Length: 404
Type: CDS
Source: GLEAN
Position: GCSC_140:2754268..2753937 (- strand)
Length: 332
>GLEAN_7324 class=GenePrediction position=GCSC_140:2755341..2753937 (- strand)
ATGGCAGTATCGGACGTCTGCCAGTATGTCGGTGATCCAATGCCAGACATCGCCGGCATTGGTGTACGTGATCGTGTTTT
TTTTCGTTCTAATCGCATCTTTCTGTATGTTTACTAACATGGCCAGATTCTCGTGGGCTTTGCTGGCCAGGCTTTCCTCT
CGCTCTTCCTCGCTTGCTGGGTATTTTTTCTGACACGGCATGGCCGACTCGGAACGCCACACACTGTGAAGTCCGACAAG
CACGCCGTCGAGAAGAAACGGCTGGAAATGGTCGAGGAAATCTTGATGATTGGCAACGACATGCAAATGGCAATTGGTAA
GCAAACCCGATAATACTCGAAGCTGTACGCACGGCTGATGCAAAGACGGTCGTCCAGGCATCGCCCTGATGATAACTACG
TTTACTGTGGTCAAAACAATCGATATCTATCATTTGCGCCTCATCTACGATACAGTCAGCTTTGTAGGGTATGCTTCGAT
CCCGCTATCGCCCACATTCGTACGTAAATACGTTCTAACAGGGCATCCTACATGCACAGCGTTTCCAATGTTGCAGCTCT
CGTCTGCTACACGTTCTGTGCGGCCAAAAGAGCCGAGTTTCACGAAAGCAACATCAACAACAACAAAGCCACTTCTTCCC
CTTCATCTGGCTTCCTTCATGGCCTCACGCTGGTACTTCGAGACGACGGCAAGAATCCCATCTGGCGCAAGTTCATAAAG
TCAGGCCGCTACCGCGTGACCTACGCCTTTGCCGTCTTATTCTTTGCTCTGGCCGTTCTTCTGAACAATAAGCTGGGGCA
CTGGGACCTGGCCACACCCGGCCGCTGCTACAATACAGCCGCCACTAGTTCACCAGGGGCTCATCACCCGAGTTCTGACC
GTGCATACGTATGGATCACTTGCGTCTGGATGCTCGCCGTCATGCTCTTCTCCGTCTTTGAAGGTGCGCACCGGCGACAC
ACTATCCTGACAGCGGCCTTTTTGCATTTTCCCTTGCATTTTTACATGGCCGTGGCACTGCGCTCGGCTAACTAGGGTCG
GTTGGGCCTGACCGCGAGCGAGTTGGCCGATAGGGGGGGCTGACAAAGGCGAGACGGAGGGCTCGGAAAACAACTGGGAT
TTTGGACAGACCACCGCTGTCCTCCTACTCTTTGTGGCCGTGGCTGAGTTCTTCCGCAAGGGCTATGGCCTGTACAAGTT
TGAGAAGAATCTGAGGAAACGGCGCCGGTTGGCAGAAGACGGCGAAGTTTCGGATGATCACGAGCTCCTCAAAATCTCCA
GCTCGAAAACGGGCAAGCAGCCGCAGCACTGCAGACAGGGAGGGGACTGCCCGGTCGTGAAGACTATTTCGATATCGAAA
CAGCAGAGAAGGCCTAGTAAAGGGCGCGATGTTGAGGCAGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62