GenePrediction:GLEAN_7325 Details

Name: GLEAN_7325
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2751472..2747942 (- strand)
Length: 3531
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2751472..2748684 (- strand)
Length: 2789
Type: CDS
Source: GLEAN
Position: GCSC_140:2748305..2747942 (- strand)
Length: 364
>GLEAN_7325 class=GenePrediction position=GCSC_140:2751472..2747942 (- strand)
ATGAAGTTTTCCAGCACCGCCCCCCTTATCGGGGCGTTGCTCGCTGGCCTCGGCCATGCGTCTCCCATGCCCAAGGCTCG
CAGTGCCCTGGCAGCTCGGGACGCCAACTGCACCTCGTTCGACATGAGCAAGAGCTTCGACCAGGCCACGCTATACGCTG
GTTCTGCTCCTGCTGCCGTGGCTGGCGAGGCTGAGGTTAACCTGTTCCTCGGACTGCCCAGCGCTGCCATCTCTGGTAGT
GTTGATGTGTCTTTCAGCCTCGACTTCCTGACGGCACCGAAGCTCCGGGTGGACCTTGGTGGCGTGAAGGCCTTGGTTGA
GCTCGCCATTCGCGCCGATGCGGATGTTTTCGACACGGTTGAGCTTATCTCCTCGGGTGACCTCTCGCTGGCCATCCCTG
GTGTCCTTGATGTTGAGGCTGGTCTCGGCCTGGCTCTGGATCTTGTGATCAGTGTCAGCGCCTCTGTCGACGTGTCTGCT
GGTTTCGAGGTCGAGTTCCCCATCGGCTCTTTCGTCGAGATCGACCTCCTTACGTCGTCGGTTTGCGACCACCAGCTGAA
CGGTCTTGCGGCCAACACTCTGCCCGTGACTCTGGGTGCTGAGGTCGACCTGTCGGCCGACATCACTCTTGTCGTTGGCC
TGCGTCTGCGTACGGAGATCGACCTGGCCGCCAACATCGACCCGCTTGGCCTTCCTCTGCTGAGCACCGGTGCTGAGGTC
GCCGTCTGGATCAACCTGTTCGACTACACTGCTCTCATCGTCGGCGGCTCCAGCGGCCTTCTCATCGATGCCACCGTCGC
TGAGGACTTTGTGCTGAACGTCGGTATCCTCATTGACGTCAACGTTGATGTGATTGGCATCGACGTCCTCGACCTGGATC
TCGCACCCACCGTTTCGGTTGCTCTTGCCACTGCTCCTGCTACCACAACCGCCGTTGCGATCAGCAGCGCCACTGGTGTC
TCGATGACTGCCACTGGCGGTGCTGCCGCTTCCGTTACTGGCTTCCCTGGATCGGGTGCACAGGCTTCCGGTTCTGCTGC
CGCCTCTGGTGCATTTGGCGCGGGCTCGTCTGGCTCTGCTTCTGGTGCTGCTGGTTCCATCCCGTCTGGCTTTGCCAGCG
GTTCTGGTGCCTCTGCTTCGGGCGTTGCCGGATCTATTCCGTCTGGCTTTGCCTCTGGCTCTGCTTCTGGTGTTGCTGGC
TCCGTGCCGTCTGCATCTGCTGCCGCCTCTGGTGCATTCGGCTCTGGTTCGGGTTCGTCTGGCTCTGCTTCCGGTGCTGC
CGGCTCCGTGCCGTCTGGCTTCGCTCCCGGCTCTGGTTCGGGCTCTGCTTCCATCTCCGTCTTCGTTTCCGGCTTCGGCT
CTGCCACGGACTCTGCTAGCCCCGTCTCTGCTACTGGCGTTGCTGGTTCTATTCCGTCTGGCTTCGCTTCCGGCTCTGGC
GCATCTGCTTCTGGTGTTGCCGGTTCCGTGCCGTCGGGCTTTGCTAGCGGCTCTGGTTCATCCGGCTCTGCCTCTGGTGC
TGCTGGCTCTGTCCCGTCTGGCTTTGCTAGCGGCTCTGGTGCACCTGGCTCTGGCTCGGGTGCCGGCTCTGCTTCAATCT
CCGGCTTCGTTTCCGGCTTCGGCTCTGCCACGGACTCTGCTAGCCCCGTTTCTGCTACTGACGTTGCCGGTTCCGCTCCG
TCTGGCTTTGCTCCTGGTTCGTCCGGCTCGGCTTCCATTTCCGGGTTCATTTCTGGCTTCGCCACGAGCTCTGCTAGCCC
GGTGTCTGCTTCTGGTGCTGCTGGTTCCGGTTCGTCCGGCTCCGGTTCATCTGGCTCCGGCTCCGGTTCGTCTGGCTCTG
GATCGGACAGCTCTGCTTCCATCTCTGGTTTCGCTCCTGGCTCTGGCTCCCCCACGGGCTCTGCTAGCCCCGTGTCTGCC
TCTGATGTGACTGGCTCGGGCTCCGGATCATCTGGCTCCGGATCTGCTGGCTCTGCTTCCATCTCCGGTTTCGCTCCTGG
CTCTGGCTCCCCCACGGGCTCTGCTAGCCCCGTGTCTGCCTCTGATGTGACTGGCTCGGGCTCGTCTGGCTCGGGCTCCG
GATCATCTGGCTCTGGATCTGCTGGCTCTGCTTCCATCTCCGGTTTCGCTCCTGGCTCTGGTTCTGTCACGGACTCTGCT
AGCCCCGTCTCTGCTACTGACGTTGCTGGCTCCAGCCCGGCTGGCTCCAGCTCTGTCCCCGGCTCCGGTTCGGGCTCGTC
TGGCTCTGCTTCCGGCATTGCTGGCTCTATCCCGTCCGGCTCTGGCTCCAACTCTGCCTCTGCTGGCTTTGCCTCTGGCT
CGATCGTCCCGGCCGCCAGCAACACGGCCACGATTGTCGCTTCCGGCACGACCTTCACTTCCGTGCCCCAGGCTGCCATG
ACGACTTCCGCTGCTGCTCTCACTGGCTTCAGCTCCGTCGTCGGCACGGGTGCCAGCTCGGACCACACGATTACCTCGAC
CTACTTCGAGACTCAGGTGGTCACGATCACGTCCTGCGCTGCCTCAGTTGTCAACTGCCCGGCTTCTTTCACCCAGAAGG
TCGTGACTCAGATCGTTGCCACCAAGACGGTCGTCTACTGCCCGTACGCCTCGACCACCGGAACCGGTGCTAACGGCTCT
GGTTCTACTCCTTCCGTTGCGACTGGCGTCCCTACGGCAACTCCCGTGAAGTCGATTGTTTTCAGCACCTTCCCTGCCTC
GTCGCAGCCGCCTGCTAGCACCTTCACGCCGCCTGCCACCGTCTCGGCGACCATCATTGCCACCGTGACGTACACTGCTG
GCACTGCCTGGACCAGCGCCTGGACCAGCAGCACTGCCTGGACGAGTTCCTGGACCATCGTCCCGGCTGTCTCCACGACT
GGTGTCGCTGCTGTCACCGGTGTCCCTGCTGCTTCGACCACGGTTGCCGTCCCTGTCGCCCCTGCTGCTTCCGTCTCGTC
GGTGGCTGTGCCGGCTGTTTCGGCTGTTCCTGCTGCTTCGACCACCGGTGTTGCTGCTGTCCCCGTCCCGGCTGCTTCGG
CCCCGGCTGTCTCTGCCCCGGCTGTGCCTGGTGCCAACAGCACTGTGGCTGTCCCTGTCGCTGCCATTGTTTCCACCACC
ACTGCTGTCGCTGCCGTTTCTGGTGTTCCGATTGCATCTGGTGCTAGCTTCGCCAACTCCACTGTTGCATTTGCGTCGAA
CTCCTCGACCGCCACCACCGTCTCGGTTGTTGCCACTCCTGCTGCCAAGTCGCCTGTCCTGAGCGTCGCTCCCGGCATCG
ACGTCACCGCTGTGGTTGCTGCTGCTGCTGGCCCGTCCGGCATCATCACTGCTACCCCGGCTGCTGCCACCACGGCTGTT
GCCAGCGCCAGCACCACCAAGGCTGTGGCTGCTGTCACGGCCTCCGCCTCCAGCGTCCACGGCTCCGGCAGCACCAGCAC
TCCCTATGCTGTTGTGACGGCCGGTGCTGGCCGCCTGCAGACGGGCGCCGGTGCGTTCGTCATCATGCTGGCCGGTGCTC
TCCTGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62