GenePrediction:GLEAN_7326 Details

Name: GLEAN_7326
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2741427..2740416 (- strand)
Length: 1012
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2741427..2741164 (- strand)
Length: 264
Type: CDS
Source: GLEAN
Position: GCSC_140:2741100..2740738 (- strand)
Length: 363
Type: CDS
Source: GLEAN
Position: GCSC_140:2740670..2740416 (- strand)
Length: 255
>GLEAN_7326 class=GenePrediction position=GCSC_140:2741427..2740416 (- strand)
ATGGCACCCGTTTCTCACATCCAGGCCGCACCGGTCCTCTGTGCCGTAGCCCAATCTGCGGCAATTCGTCGTGCCCTGTC
TGCTGCCGGTCCCCTTCTCGTCCACCGCGCTGCGGAACATCTCCGGACCCACCAATTGTCTGCTCGCGGCTTGACAGTGT
CCAACACGCAGAAAGTCACGCTGGGCGTCATCGCTGCCTATATCGTAGCTATCGCCCTGCTGTGGAATATACCCTATATA
CGCTACATATTGTGGCCCTTCAAGGTGAGCCCGCTACAACGAGCACGTTCTGTGTCCACCTTTGCTGACAGGGTGCGTTG
GGTCCAGATGCTCGTCATTGCATTCCACGAGTTCGGCCACGCAATTATGGCGGTCCTGACGGGCGGCCATGTCATTTCCA
TCTCGCTCGACCCGCGCGAAGGCGGTGTCACACATATGAAGGGTGGCAAGGCGGCGCTCACGCTGCCGGCGGGCTACTTG
GGATCCTCTCTGATCGGCGCTCTGCTGACCTTCTGCGGCTTCGACATCGTGGCAAGTAAGGTGGCCAGCATCGTGCTGGG
CGTGTGCTTTCTCCTTACCTTGTGGTGGGGCAAGCGTGACTGGTTGACCATCGGCACCATTCTGCTCGCTGTCGGACTAC
TTGTTGCTTTCTGGTTCATCAAGCACGCCGAACCGCTGCGGTTCTTTGTCGTGAGTGCCCTTTCTTTCATACTGCGTCTT
GCAAGGACGGCAATTTGGTTAACACTTTCCGTTCCAGCTCTTCATCGGCGTCATGTCGTCGTTGTATAGCGTCTGGGATA
TCTGCGACGACCTCATCCTCCGCAAAGTCAACGAATCCGATGCCAGCGTGTTCTCTAAACGATACGGCGGTTCGTCGCAG
TGCTGGGGTGTCGTCTGGTCCATCGTTTCGATTCTTTTCATGGTGTGCGGCATCATAGCCGGCATCGCCGCATTCCCCGA
GTCGTTTTCCGAGCAGGAGAAGGACTCTGAGAAGTTTATCCCGACACGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62