GenePrediction:GLEAN_7329 Details

Name: GLEAN_7329
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2731283..2730173 (- strand)
Length: 1111
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2731283..2731194 (- strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_140:2731134..2730727 (- strand)
Length: 408
Type: CDS
Source: GLEAN
Position: GCSC_140:2730652..2730173 (- strand)
Length: 480
>GLEAN_7329 class=GenePrediction position=GCSC_140:2731283..2730173 (- strand)
ATGCTGCACATCACTCCGTGGAAGGCAGCTGCCTTTGTAGCCACCATCCTGTTGGTTTTGTATTCGTTGGCACAGTTCTC
TTCCTTTCAAGTAAGTTCATCAAACAGCGATTACGAAAGAAAGCACATACTCATTACCACAACAAACAGGATCTCAGAGA
CAAAACCGCTGCTACCATCGCACATGTTACGCCAATCGAGAAGTATCAACGACCGCTGGTACTTTATGCATATGCGGAAT
CCGACACTAGCCGCGAGAACCTGGACTTTTTCGTGCAAAAGGGCATCCATGGCGCGGCCGACTTTGTTTTCATCTTCAAC
GGGCCGACAAATGCCACCGACCTGATCCCCAGTCATCCGAACGTGGAAGTGGTCAAACGAAATAATACCTGCTACGATCT
GGGGGCCTTTGGCGAGGTTCTGCTAGCAGGCGATCGGTGGAAGAGCTACAAGCGATTTGTTGTCATGAACGCAAGTGTCC
GCGGGCCGTTTTTCCCAAACTACATGAAACCCTGTTGGACGGATGCATTTCTCAATCGCCTCAACGATCGCGTCAAGGTA
TGTACTCCCGGTTCTTCGCACGAAGCAGTTTGTCCCTGGGCTGGAGACTGATCGGCTCTTTCGAATTATAGCTGGTGGGC
ACAACAATCAACTGCTTCCCACACCCGCACCTGCAGACAATGGTTCTGGCCACGGACGACGTGGGCATGTCCATCCTGTT
GAATCGTACGCTCGCAACATCCTTGGATAATGTGGACAAATGGGGGGGGAAAGACGACCCTGTTGGATTCACGGCCTGCT
TCGAAGACCGAAACAAGGCGGTACATTCCGAAATTGGCATAACCGGGCTGATCCGGTCGCAAGGGTATGACGTCGATGTC
ATGCTGACCTCGTTTAGCGTCGACGAAGAGGACCTTACCTCGTATTGTGCAAGCGACAAGCGCAATGCTGACCCGCTTGT
CGACGGGCATTACTTCGGCGCCAACATTCACCCATACGAAATGGTTTTTATGAAAACCAACCGTCACGTCGCCGAGACGA
CGATGGAGATAATGACAGAGTGGCACCGGAGCAGGGGATGGTCAAGCTGGGATGCTTGCCCGGCTTCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62