GenePrediction:GLEAN_7332 Details

Name: GLEAN_7332
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2725640..2723230 (- strand)
Length: 2411
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2725640..2725518 (- strand)
Length: 123
Type: CDS
Source: GLEAN
Position: GCSC_140:2725446..2723230 (- strand)
Length: 2217
>GLEAN_7332 class=GenePrediction position=GCSC_140:2725640..2723230 (- strand)
ATGTCAGCAATGGACTCTGTTCAAAGCCAGGAGTTCCTCGTCCGAGACCTGCCCACCCGCTCAGTTTCTCTGTTTCCAAC
ACGGGCACAGGTGGTTCGGGATATCAAGGGTGTCATCTTGAAGGTAAACACAAAGCACAATGTTTGCCTGATCCTGTATA
TCCTCATCTTGTCCTTTGCTGATACTCCTTACAGCCAGGAGCCAACCAACTTACAGTTGTAGGTTTCGCTCCGACGACGG
ATGAGAACTCCATCAAGGTTGAGGGCACCGGGTCTGCAGTCATCTCGGACATTGCCATTGAGCTGCTGCCCAACCAGGAG
GACTTTGACGACATCTATCCTAGAAGCGATGAAGAGGAGTGCCCTCAGAGTAATAATGAGATGAGCGAGGATGAGAGCGT
GGAGGTGAAACAGACGCGTGTGAAACTGGAAGAGGTCCGTAGTCGCATGACAGCGCTGCGTGACACGGAGAAGGCTGCGA
AGGAGACAGTGTCCAGCGCAGAGAACCGGCTGAGAATTCTGGACGCGTACGGAAAGTTGCTTGACAATGAGCGAAGCTTG
GCAATTAGTGAGGCCCTTGAGGCATACCGGACGGAGCGCGCCAAGGCGTTTGGGGACCACATGAAGGGCGAGCTCCAGTT
ACGGGAACTGGCCAAGACGATCGCCAAGGTGCAAGACGAGGAGAAGAAGCTGGTGCAGCTACAAGTGAGAAGGAAGATGA
AAGAGAAGTGGCTCGAGATGAAGGCGAGTAAGGCCGAGAAACGGGAGAAGAAGCGAGAGCTGGAGAAGAAAAAGGAGAAG
GACCGGATCAGTGAGGAGTTGAAGAGTCTGTGGCCTTCACGGTGCTACACGGTGCGCATCACACTGGATGCTGCGGGCTA
CACGCCGGCATCGTCGCGACGGACGTCGATTGCCAGTGTGACAGAGGTATTGGGGGTGAAAGGAGCGGGCGAAGGTGGCG
AAGAATCTGCGGTGGACGACACGGCCGACCTGACATGCGACTTGACCATCTCGTATGTGACCACGTCGGCGTTCTGGTCG
CCAAAGTACGACCTGCAGCTATCGACGACTACGGGATCGGCGGTGCTGTGCTTTGACGCGGACCTGACCAACAAGACGTC
AGAGACGTGGAGCAGCTGCAAGGTAGTGCTCTCGACGAGCCAGACGACCTTTCCCGGCCTCAACGATGCCATCCCGACTC
TCGTGCCGTGGCACGTCAAGCTAAACAGGATCGGCTTCTTGATTTCAACTTCCGGCCTCGGTAGCATCACTCAGAGTCGC
GAGGAGCTCGCATACAGCAATGACAAAGCGACTTTGGCGGCAAATGAGCAGCCGCGCAACAAGTCGAGTAGACAGCAGAA
TCTCTTCGCGCCACAAAACCAGATGTTGTTTCAACAGGCACAACAGCCGACGCTACACGCTATGTCGGCTAGGTCAGCAT
TTGGCCGAACCACCGGCACCCTTTTCGGCGCGGCCTGTCCACCGGCTGCTTCACCGCAGCCCGCAAACGTTACCGGGATA
ATGCGACACGGGATGCAAGTCGGTACTACCAGCAACTACGACACTGACGAAGAAGACGACGACACGATGGCGGGGGCACC
GGAGCTGGATTTCCAGGATTCGGCGTTTGAGGAGATGGGGCTGACGACGACATACGATCTGCCAGGACTGAAGACTCTGG
CGTGCAGCACGAAGACGTCCCGACAACGGGTGGCACGCATCAGCCTGACAGGAGGCACTGTGGTGTTCAGCCATACGATT
GTGGCCAAGTACAAGCCAGCAGCCTATCTGAAGGCGCGGATCAAGAACGCGAGCAAGTTGACGCTGCTGCGAGGACTGGC
TGGCCTGACGCTGGATGGCGCATTTCTGGGTCGCACGACGCTGCCTCGCTGCAGTCCAGGCGACTCGTTCTCGCTCAACC
TGGGCGTTGATCCGACGATTCGCGTGGTGTACCCCAAGCCCGACATCAAGCGGGCCAGCGGAGGTGGCGGTCTTCTCATC
AGCAAGGACAACAGCGGGACCTTCCGGCGGTCCACCACAGTAACCAACACAAACCCCAGGACGCGTGCTGGCAGCGGCAA
GTCGGCCACGCTGCTTGTGCTCGACCAGGTGCCCGTCAGCGAGGATGAAAGGCTGCGGGTCGAGATCCAAGTCCCACATG
GGCTCGCCGTCGATGGATCATCCGTGGCTGCCGGCGAGGGCGTAGCCTCGGCAACTATAGATTCTGGCAGTGGCAGCGTT
TCATCTTCTGAAAGTACGGCCGCGATCAAGGAATGGGGCCGGGCTTCAGCCACGCTGAAAAAGGCTGGCCAGGTCACGTG
GGACATGGAGCTCTATGCCGGCCGGACGGCTAGGCTGGACCTGGAGTACGTAGTCACGGCGCCGGTGGGTGAGGGGGCCA
CACAGTGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62