GenePrediction:GLEAN_7333 Details

Name: GLEAN_7333
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2717151..2715774 (- strand)
Length: 1378
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2717151..2716954 (- strand)
Length: 198
Type: CDS
Source: GLEAN
Position: GCSC_140:2716845..2716528 (- strand)
Length: 318
Type: CDS
Source: GLEAN
Position: GCSC_140:2716464..2716322 (- strand)
Length: 143
Type: CDS
Source: GLEAN
Position: GCSC_140:2716254..2715774 (- strand)
Length: 481
>GLEAN_7333 class=GenePrediction position=GCSC_140:2717151..2715774 (- strand)
ATGGACATGGACGCGACCAACATCACGGCACTGCCGGCACTAAAAGCCGTCACGGCCACCGACCAGGGTGGTATCCTGGC
CATTGCAGCCAGCATGGCACTCGTCTTCGCCATCCTCTCGCTTCTGATTCGTGCCTATGTGCGGATAGAATGCGATGCCG
CATTTGCCAGTGACGATTTGTTGTCATGTCTGAGTATGGTAAGTAAGAGACAACGGCCAACAGAGCCACCAAGACAATAT
GCGGAAAAAAAGAAAGAGAGAAGAAGCGGGAAACGCTGACCGGCTCAGGCTGCCACTGTAATTCAGACGAGCGTCGTGTT
CCTAGCCATAGCCCGCGGCTTTGGACGTATCTCATCTGATCTCACGGTCAAGGCCACCAGCGACTGGCAACGCGATATTT
ACGTGGCCGACATCCTATTCCTCGTCGGCATGTGGCTCACAAAGTGCTCCATCGCCCTGCTGCTGATGCGCCTCTCACGC
GACCCTGGCCACACCTTCATGTCCAGGGCCCTGATCGTTGGTTCGACCTGCTACTTTGTCATTTCCGTTTTCGTTGTCGC
CATCCGCTGCGACGTATCAGAGCCGTGGAGTCCCGACGGAGCCAAGAACTGTGACTCGAGCACCGTAAGTGATTTCGTGA
TTCCGTGATTCCGTGATGTGTTTGATTACACATGCTGACCGGCTCAGTTTGCCCGCTGGTCGGCCGTCACTGCTCTGGAC
GTCGCCACCGAGGCCGCTCTCTTCCTTGGCAGTCTGCAACTCGTCCACGGCCTGCAGCTTCCATGGAGCAAAAAGTCCGT
CGTGGTCTTTGCCTACGGCCTTCGTCTTCCGTAAGTTGTCACCGGAAAGACGAGAATCTGTTCCGGCTTTTGCTAATCCA
GATTCCTCCCCTTCCAGCCTTATCGCTCTCGCCGCACTCCGGCTGCAATACCTTCACAAAGGCATATACAGCAACGACCA
GTCGCTGCACGGCATCCTCGCTTCCGTCTTCACACAGATCGAGCTGGGCTACGCCGTTGCCGCCGCAACGATGCCATGTC
TTAAGCCGTTCATGTCCGCTCTCAACACGCAATATGGCGGAGGCCCGGCTTGCATCGTGGTCAACCACTCCATCGTGACA
GCTCAGAGGAGTCGTGACTACTCGGGCAACGGTTCCGCAGTAACGCCGCTTTCGATGTCGCGCAAATCCACCGAGTCCGA
GACACGCTTTTTTGAGAACAAGGCCATCGCCGGCGTCGACGTCTCCATGCACCCGCTACCACAGATGCCAGGCACTGCCG
GAAGACATAACCGGGAGGAAGAGGAGAACGACCGGTCGGGATCACTGTTGTCGTCAACATCGGCTCACCGTGTCCACGCT
TTCGGTGAATCGGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62