GenePrediction:GLEAN_7334 Details

Name: GLEAN_7334
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2712955..2711234 (- strand)
Length: 1722
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2712955..2712740 (- strand)
Length: 216
Type: CDS
Source: GLEAN
Position: GCSC_140:2712678..2712310 (- strand)
Length: 369
Type: CDS
Source: GLEAN
Position: GCSC_140:2712244..2711234 (- strand)
Length: 1011
>GLEAN_7334 class=GenePrediction position=GCSC_140:2712955..2711234 (- strand)
ATGGCAGACTCAGAGTATGACAAGTCTTTCGGTGGACAGGCTGTCCTGTCACCCAACATCGACCCGCCGCATCACAACAT
GACTGCTTCCAAGTACATCAGAACGCGCATCAGCTCTTTGAAGCCGCCCATGACCAAGACTCCAAATCCATTCCGCCTCA
TCGCGTCTGTCACCCGCATCCAATGGGCCTTTTTTTCCGTTGCCTTTATTGCATGGGTCAGTTTCCCTTTTCTTCTCTCT
TCTCCTGTTTTGCCTCGTCGCTGACTGACCGCCGCAGACCTGGGACGCTTTCGACTTCTTCACCGTCTCGCTTACTGTCA
GCGACCTGGCAGAAACCTTCAACAAGACCAAAACTGACATCACATGGGGCATTACTTTGGTGCTGATGTTCCGGTCCATT
GGCTCCATCGCCTTTGGTATCGCTGCCGACCGCTACGGCCGTAAATGGCCCTTTGTTTTCAACAACGTCCTGTTCATCGC
CCTCGAGCTCGGCACCGGCTTCTGCCAGACCTATCGCCAATTTCTCGCATGTCGCGCCCTCTTCGGCATCGCCATGGGCG
GTTTGTACGGTAACGCTGCCGCAACCGCTCTCGAAGACCTCCCTGAGGACACCCGTGGCATCATGAGTGGCATCCTCCAG
CAAGGCGTACGTTTGCTCTGCTCTGTTTTGCTCTTCGTAAAGACTGCTTATTAATCACTCTTCTCATGCAGTATGCCTTT
GGCTACCTTCTGGCCACGCTCTTTGCCCGTGCTCTCGTCAACACCACCCCTCACGGCTGGCGTCCACTCTACTGGTTTGG
TGCCTGTCCGCCCGTGCTGATCATCATCTTTCGTCTGATGCTGCCCGAGACGGCCACCTTCCAGGAGCGCGAGGCCGTGC
GCAAGAGCGCCGAGGAACACGGCGACGGCAGCGTCACCAAGACCTTTTACCGCGAGGGCAAGGTTGCGCTGCGCCGCCAC
TGGATGATGCTCACCTACCTCGTCCTCCTCATGGCCGGCTTCAACTTCATGTCGCACGGCTCGCAGGACATCTACCCCAC
GATGCTGACGAACCAGTACAACTTCTCGGCCAATGCCGTCACCATCACTCAGGTCGTCGCCAATCTGGGCGCCATGACCG
GTGGCACCCTCGTTGGCTATGCTAGTCAGATCTTTGGCCGTCGTCTTAGCATCATCGTCATGTGCATTTTCGGCGGCGCT
CTGCTGTATCCCTACACCTTCGTCTCGAACGAGCGGATCATCGCGGTCGCCTTCTTCGAGCAGTTCTGCGTGCAGGGTGC
CTGGGGTGTCATCCCCATTCACCTCATGGAGCTGAGTCCGGGAGCGTTCCGTACCTTTGTTGTTGGCACGGCCTACCAGC
TGGGCAACCTCGTCTCCTCGGCCTCGTCCACTATCGAGTCCACCATTGGCGAGCGCTTCCCGCTGCCGCCCAAGGGCAAG
GTCAGCCGCTACGAGTACGGCAAGGTCATCTGCATCTTCCTCGGCTGCGTGTATGTCTATGTCATCGTCTTGACCCTGAT
CGGTCCCGAGCATCTGAGGCGGAGCTTTGATGCCGAGCATGACCAGGATCTGCGTGCTGTTGCCGGCGACGAAACTGTCG
TTGAGGCGATACACCGGCGCGAGCGCATGGGAATGGGCCTGAGCGAAGACGACCTGGAGGATGCCGCGGCCGTGCGGGAG
GCCGAGAATCGCGAGAAAATCGTCGTGGGACACATAGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62