GenePrediction:GLEAN_7335 Details

Name: GLEAN_7335
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2704091..2702332 (- strand)
Length: 1760
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2704091..2704062 (- strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_140:2704000..2703919 (- strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_140:2703846..2703670 (- strand)
Length: 177
Type: CDS
Source: GLEAN
Position: GCSC_140:2703590..2702987 (- strand)
Length: 604
Type: CDS
Source: GLEAN
Position: GCSC_140:2702923..2702332 (- strand)
Length: 592
>GLEAN_7335 class=GenePrediction position=GCSC_140:2704091..2702332 (- strand)
ATGGCGTATTCCGAGCAACACATCAAAAGCGTATGTTATTATGCGGCCTGGGTATGATAGGAGCTAACGCGAGTCCTGCA
ACTGTGTACAGCTGAAGAACAAGAGCTTGTTTTCGGGCGAGGCCCTCATTGACGGAAAATGGGTCACCAAGGACAAAAAG
TTTGATGTCTATGGTACGTGTCTCTAGCGGGTCATATACAAATAATTGAACAAATGGATAGACTGACTTGCATGTAACCA
TACAGAGCCCTCGAGTGAGGCCGTTCTCGGCCAGGTGTCCAACTGCTCGCTAGAGGACTTCCAGACGGCCATCCAGAGCG
CCGACGTGGCACAGCGAGCCTATTTTGAAAGCACCACGGGTGCGAAGAGAGGCCAGCTGTTGCGGAGGTGGAACGACCTG
GTCCTGGAGAACATTGACGATCGTGAGTCCAGTCCTGTCTCTGTCTGCCGCCGTGCTCCCTTGTTTCGACTCTACACAAC
ATCATCCTAACCACAATGCAGTCGCCGTCATCCTCTCGCTCGAAAACGGCAAGACGCTGAGCGAGGCCAAGGGCGAGGTG
CTCTACGCAGCCAGCTTCCTCGCCTGGTTTGCCGAGGAGGCCACACGTGCGTACGGCGTGACCATCCCGTCGTCGACGCC
GCACACGACGCTGATGACGCTGCGCGAGCCCGTTGGCGTATGCGCCATCATCACGCCGTGGAACTTTCCCGCGGCCATGA
TCACGCGCAAGGTTGGTCCAGCCCTGGCGGCCGGCTGCGCCGTCGTGATCAAGCCGCCCAGCGAGACACCCTTTACCTGC
ACGGCCTTGACCAAGCTGGCAGTCCTGGCCGGCATTCCCCCGGCGACCATTCAGGTCTGCCCGACCAAGGACCGGCAGGC
GGCCACGGAACTCGCCACGAACCCGCTGGTCAAGAAGCTCAGCTTCACCGGCTCGACCGGCGTCGGAAAGATGCTGGCTA
AGCTAGCCACTGGCACACTCAAGAAGGTCAGCCTCGAGCTCGGCGGCAACGCGCCCTTTATCGTCTTCAACGACGCCAAC
CTCGACCTCGCTGTCGAGGGCGCTATGCTCTGCAAGTTCCGCTGCTCCGGACAGACATGCGTCTGGTACGTTTTGTCCCC
TCTCTTTCACCCCTTTTTCCCGCATCCGATCTTCTTCTGACCGCTCAGCGCAAACCGTCTGTATGTTCAGAAGGGCGTGG
CTAAGGAGTTCACCGCAAAGCTGGTTAAGGCAGTTCAGGTGCTCAAGACCGGTCCCGGCCTGGACGCGACCACGACCCAG
GGTCCGCTCGTGAACAAGGCCGCCGTCGACAAGGTCCGAGAGCATGTGGCGGATGCGGTTGCCAAGGGCGCCAAGATTGA
AGTCGGCGGCAAAGTTACGCGCACTACTGGTTTCTTTTATGATCCCACCGTGCTCTCGGGCATGAAGTCTGAGATGATCG
TCAGCCGCGACGAGACGTTTGGTCCCCTGGCGCCTGTTTTCGAGTTCGAGACCGAACAAGAGGTTCTGCGGCTGGCCAAC
GACACCGAGCTCGGCCTGGCCGGTTACTTCTTCTCCCAGGATATTGCGCGGGCCATGCGCGTCGCACAGAAGCTGCAGGT
CGGCATGGTCGGCGTCAACACGGGCAAGATCAGCGCTGCCGAGGCGCCCTTTGGCGGCGTCAAGGAGAGCGGATACGGAA
AGGAGGGCAGCCTCTACGGCATGGACGAGTACCAGATTACGAAGAGCGTCACGATCGGAAACCAGGATGCTGGTCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62