GenePrediction:GLEAN_7337 Details

Name: GLEAN_7337
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2699485..2698631 (- strand)
Length: 855
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2699485..2699412 (- strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_140:2699199..2699152 (- strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_140:2699000..2698631 (- strand)
Length: 370
>GLEAN_7337 class=GenePrediction position=GCSC_140:2699485..2698631 (- strand)
ATGTGCTACATTGGGGGCAGCCCTGAAAGAGAGGATGGGTTCAGTGATCACCGCGCCGAGAACATTCTTGAAAGGTAAGT
GACGCAGAGGTGTTGGACGGTGGTTGATCCTTGAGGATCGGACAAACTGCCACACTCGTCGGGCTTGAGGCTGGTTGGGC
CAGAACTGGTCGCCCTACTCCTCATTTATTCTCTACATGAAGTCGGATAACTTCTTGTTCTCTTTCCTTTACAACAAGGT
TTTATAATCTTCATGCTAATTTCATCAACTCAACCTTGAAAAGCAGCTTTGTGCATCGCATAAATCGCCATATCTCGATA
GTTTTCGAAAAGGAGTACGTACAACTATCCAAGCTCGCCTAGTTCTATTATTTGATCCTTATAATGCACTCTTCTGTCTT
TAGAAGTGTTTATCTCCAATCCAAGCTCGTATTCTCTTTACCGGAGTGTTCCATCACTAACAATAATCGTCTTCCTGTCT
TTTAGAGAACAATACTATCAAGGCTTCACTCCCCTCATCTTCACCATGGCCGCCCGTGTCCCTGCTGCTAAGGCTACAGA
GCTCGTCACATTTGGTGCTGCTGGTCTGGTCGGGTTTGCACCCGTCTACTTATTGTTTGCACCCAAAGGGGATGAGCAAA
TGGCCCGTCAGACTACCCGCTGGGCTCCTCGTTGGGAACATGTTACTACCAACTATCTCACGCCGCCGGTTGAGAACACC
GTCCGGAACCACATTTCGCCTCCCATTGAGCGCACTATGAAGCGCTTTGATCGTGTGGCCAACCCACACATGGCACGGGC
TGCACAGAACCTCGACCGGCGGATCCGAGCAGGCATCGCGCGGGTGCAGAAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62