GenePrediction:GLEAN_7338 Details

Name: GLEAN_7338
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2692483..2690010 (- strand)
Length: 2474
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2692483..2692127 (- strand)
Length: 357
Type: CDS
Source: GLEAN
Position: GCSC_140:2692019..2691321 (- strand)
Length: 699
Type: CDS
Source: GLEAN
Position: GCSC_140:2691263..2690010 (- strand)
Length: 1254
>GLEAN_7338 class=GenePrediction position=GCSC_140:2692483..2690010 (- strand)
ATGGAGGATCAGCCACGCACGCCGGAGGTACCGGAGTTTGCTCCCCTGAGGCCGCACGACGACATCGCCGCGCTGGAAGA
CCAACAGCACGAGCAGCACGAGCTGCATGAGCAGTTGCGGCCGTCATCTCGTCAGAGACGCTGCACCACGCCCACCACTC
TAGGCCTGACCTATTCGGCCTCGCCCAGCGCCAGTGCTACTCTGCTCTCTTCTTCAGAGACGCTCAAGCCTGCGATCGAT
CAACAGGTCGACTTCGACTACATGATCTCGCCGCCCTGGGCACCCTCGCCCGGTCCTGATCGTCTGAGCAGCCTCAGCGA
TTTCCCCTCGAGTGCCACGTCCCTTCGCAGCAGTCAGGTAGGTTTCAGTCCCGGTTTGAGCTTAGTTCACAACCCCTCTC
CCTTACCTTGCCCTTTCTTCCTCTTCTCTCTCTCCCTTGGTCGCCTCTCGCTCACATCCGACAGAACCCCAGCCACCTCA
GCTTGGCCGCCTTTCTGCCCAAGAACGCGTCAGAGCCCCGTGACAAGAGCGTGCCGTCAGAGTCCATCGTGCAGCTGCAC
CGTCGGGACGATGCCGAGATCTCCAAGGGCTGGAAGCGCAAGGTCGTCAAGTTCGCCCCGCTGCTCACCTTTTTTAGCAG
CGCCGCGTACGTGGTCTACGTCACCTTCCGCATCTACTGCGTCGTCTCGGCCCAGAACAAGAACCACCGCACCTATGCAC
CCGCCTGGGTCTTCATTGCCGTCGAGCTGGCCACTGCTATCCCCTCTATGATCCACAATATCTGGACCATGATGGCCGTC
AAGCGGAGACACCGCCCGAAGCTTCGGCTGACCGGCGAAGACGTCCCCACTGTCGACGTCTTCATCACCTGCTGTGGCGA
GGATGATGAGCTCGTCCTCGACACCGTTCGTGCTGCCTGCGACCTGGACTATCCGCGTGACCGTTTCCGTGTTGTGCTTC
TGGATGACGGCAAGTCCGAGGGCCTCGATAAGGGCTGCAACCAGCTTAACTCTCTGTACGGCAATGTCTTTTACGTCTCC
CGGCCCAAGTTCCCCGGCGTGCCGCATCATTTCAAGTCGGGCAACCTGAACTACGGCCTCGGGGCCGTCACTCAGTTCCC
CGGAGGGCCTAGCGAGTATATTGCTGCCCTGGATGCCGACATGGTAAGACATCGCTCTCTTCGACTGCTTTCTCTATTTA
CTCATGCTAATCCCCTACAGATTCCAGAGAGGATTTGGCTTCGGGCTATCCTGCCCCATCTGATCATCGACCCCAAGATG
GCCCTGGCCTGCCCGCCCCAGCTCTTCTACAACACCCCCCGGTCCGATCCGCTTGCCCAGAACCTGGATTTCTTTGTGCA
CGTGATCGAGCCTATCAAGGACTCTCTCGGCGTCGCCTGGTGTACAGGTTCTGGCTACGTCGTCCGTCGCGAGGCTATTG
ACGATGTCGGCCACTTCCCGCTTGGTTCCCTGGCCGAGGATGTGGCCACGTCGACCCTGATGCTTGGAAAGGGCTGGAAG
ACGGCTTTTATTCACGAACCGCTCCAATTCGGCACTGTCCCCGGCGACTACGGCAGCCACATCAAGCAGCGGACTCGTTG
GGCCATCGGCACCGTCGACACCTCGTTCAAGCTCAACTTCTGTCTTTGGGGCGAGAAGGTCCGCTACATGACCCTGCCGC
AGCGCTTCTCCGGCTTCCTCTACTCTTTCCTTAGCTTGTACACCATCCTCTTTAGCATCTCGCTTTTTGCCATCCCTATC
ATTCTGATCATGGGCAAGACCCTGATCGCCTACGCGACTACGAACCAGCTCCGCTGGCTTATGCGGCTCTGCTTCATCCA
GATGATCACTACCCGTGTCGACGAGCTGCTGGTCTTCTTGCCCGCCGGCTACCACAACGGCCAGCGCGGTTCGCGCTACC
TGCTCTGGATGGCCCCCTACATCAGCGTCTGCCTCATCCGCGCCTTCATCTTGCCCAAGTGGCTTGGAGGCCAGGCCCAG
GCTTTCAAGCCTACCGGCTCGCTCGGCTCTGCCCTCAACGAGCGCGATGCCAAGCGCCGGCGCAACGTCTTCATTCGCCT
CTGGACCATCTTGATCAACTACAACGCCATCTACCATCTGGTCTTTGTCTACTTCACCTTGATCGGCGTCACCTACAGCT
CGTACCGCTGCATCTCCGAGAACACCACCGTGCACAACACACTCAAATGCCTGGTCACCCACGCCTTCTGGCCGCCCATG
ACCTTCCTCTTTCTCTGCACGTCGCTCTGGACCCCTGTCGCCTACGCCATCTTCCCGCCGTCCGAGCCCGACCGGGAGGA
GCTCCTGGTCCGCGACCCCAAGACCAACGTTGCCCACCCGACCGAGCAGAGCAAGAAGACCGCCTTTGGTGGCCAGGCCG
CCTGGTTCGAGCTCGAGTACACCATCTCGACTGCCTACACATGTCTGATCTTTGGCTGCTCCTTCTTTTTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62