GenePrediction:GLEAN_733 Details

Name: GLEAN_733
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1725765..1726655 (+ strand)
Length: 891
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1725765..1725930 (+ strand)
Length: 166
Type: CDS
Source: GLEAN
Position: GCSC_97:1726009..1726347 (+ strand)
Length: 339
Type: CDS
Source: GLEAN
Position: GCSC_97:1726423..1726655 (+ strand)
Length: 233
>GLEAN_733 class=GenePrediction position=GCSC_97:1725765..1726655 (+ strand)
ATGACGGGCATCACGGCAGACACCATCCTGAAGCTGTTCCCAGACATTGACACCAGCGGTGAGGCCCTCGAGGGCCATGA
CGAGGAGCAGATTAGGCTGATGGACGAGGCGTGCATTGTTCTGGACGAGAATGACGCCCCAATTGGCAAGGCGAGCAAGA
AGATCTGTACGTGTCCTGAGAGAGAAGGGGATGCAAGGAGATGACGCATGTGTAAGAGACAGGACGATGACTAACAAATT
CCAGGCCATCTTATGACCAACATTGACCGCGGCCTGCTGCACCGGGCTTTTTCCGTCTTCCTGTTTGACGAGCAGAACCG
GCTGCTGCTGCAGCAAAGGGCAACGGAAAAGATCACGTTTCCCGACATGTGGACCAACACGTGCTGCTCGCACCCGCTGG
CCATGCCGAGCGAGACCGGTGCCACACTTCCAGAGTCGGTCGCCGGCGTCAAGCGGGCGGCCCAGCGCAAGCTGGACCAC
GAGCTGGGCATACCGGCGGCGCAGGTGCCCATCGACGACTTCCGCTTCCTGACTCGCATACACTACAAAGCGCCTAGCGA
TGGCAAATGGGGCGAGCACGAGAGTATGTATTTCTTGCTTTTGTTGTTCTGTTCCAGTTGTCTTGGTTGGTCTTGGTACA
TGCTGACTAAGCATGTAGTCGACTACATCCTGTTCATCAAGGCCAAGGTTGACCTGGCGGTGAACGAAAATGAGGTGCAG
GCAACGCGCTACGTGACGCCAGACGAGCTCAAGGCCTTATTTGAGGACCCCAAGCTGAGCTTCACGCCGTGGTTCAAGCT
GATCTGTAACTCGATGCTCTTTGAGTGGTGGCAGAACCTGGACTCGGGCCTGGACAAGTTCACCAATGAGCAGGAGATCC
GGCGGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62