GenePrediction:GLEAN_7340 Details

Name: GLEAN_7340
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2676545..2673998 (- strand)
Length: 2548
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2676545..2676235 (- strand)
Length: 311
Type: CDS
Source: GLEAN
Position: GCSC_140:2675784..2675632 (- strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_140:2675552..2673998 (- strand)
Length: 1555
>GLEAN_7340 class=GenePrediction position=GCSC_140:2676545..2673998 (- strand)
ATGTCGACCATCGTACGCGCCACGGCCCTTCGCGCCGGCGGCGCCTGTGTCCGCTGCCGCAAGGGAAAGACAAAGTGCGT
CTACGAAAACGGCCGAGCACCGTGTCGAAACTGCGCCAAGGGCATGCACGAATGCTATTTGCCCTCGGAGTCCATGAGCC
ATGGTGGTCATGGCGTCTCTCCAGCTCGGATCCCCCAGCGCAGCCGCGAGTCCCTTTCGGGTGACAGCCGGGCTACTGGC
GGTGTTGGTGCCGACCGTCCAGCTCCTAACCTGTCGGCCGCATCGAGGCATCCTGCCATCGGCATTGAAAAGTGAGTATA
TTCTCTTTGTTTCACACCTGCATTACAACTGCTACTCTTTTCGCCGTCCGTTAGCTCCCTTCCTGCTTTCTTGTCTCAGT
CGAAACTTCCGTGACCTGGAAAATCATCCCTTCTGTCTGCTTGCTGCATATGCCCTCTGTCTACCCTCTCTTCCTCTTGC
AGACGGTTAGCCTTTTCATCGGCCTCTAAGCTTGTCTTGTAACGGTTCTCCCTGCAAACTTCCCCACTTCAGTCTAGACC
CGCTCGCCTTCATCCTACGAAACATTCCTACAGTCTACCCCAATGTGTCCTCTCGTGTGTTGCGGAGTAGTACATACAGC
ACCACCCCGTCTTCAGACACCTGTTACGGTGCTGCTATCCTTACTACTCTCTGCCCCACCACCCTTCTCGAAACACCACC
TGCTCTTATCACTTCAAGCGCTTTACTAACCATGGCTCTAGACTCACTCCCGAGCTTATGGCCGAATGCGAACGAGTCAT
CTCCAAGACTCTCCCAGCATGTGTGGCCTTTCATAAGCCGTCTTTCCTGCAACAACTCAAAAGCGCTACTCTCGACCCAT
CTATGGTCCACGCTTTACTTACCATTGCTTCTCGGTACGTGTCAATGCCTCTATTTACTACTGGCCTTTTTCTCTGTTGG
CCCTTTCTTCGAGAGCTTTACTAACGTATCTAGGTATTCACCAAATTTGACCCGCCGGTATGGAGGTCACGGTGGCGGGA
CTGCTGCGGCCGAGCACTTTGCTCAGAAGACGATCAATCTGATCATGCAGTCCCTCGACCACCCCACCCTCGGTGACATA
CAGGCTCTTTGCCTTCTGGTGATCCATGAGTGGGGTTGTCGCAATGCCGTTCGTGCTTACATCTACCTCGGCCAAGCCGC
GCGCATGGCCCAGATGTATCGCATCGTCCAGACGCACCAAACGACCGATGCGGACAACTTTCTCAAGGAAGAGGCTTTCC
GCCGTACGCTGTGGTTGATCTACGTCCTCGACTGCTTCTTGACCAGCAGCCCTGGCCGCCATCCCGCCTTGTCCTCGCTC
GACATTGCAGACGTCGCTCTGCCTTGTCAGGATATGAACTTTAATTTCGGCAGCCCGGTCTTTGTCCGTACTCTTACCGG
TGCTGCACCTGGCGTGGCTCCTGATCCGGATGCTCCACTCGCCGACGTTGGCGAGTTCGCCTACATTGTCCTCGCGACGA
AGATCTGGCGCAGTGTTGTCGAGATGATGACGACAACAACGATCGACAACTTCTCCAACTCTCGATGTGTCGATCTGGAT
GCTGAGATCGACGCCATCCGCCAAGGCCTTCCAGTGCACTTCGCCGACAAGGCAGGCCAGATCAATCTCCACATCACCAT
GGGCAGTGGCTTCACATATGCCATGATCCATTGTCTGCTTCAGTGCGCCACGATATTCGTGAACCGGCGACAGATTCTCC
AGTTTGTCACCACGGACAACTTCAATGCCGACGATTGGCATGCTAGTGGCACAGACAGCCATTTGATTGATAACGTCTTT
GCGGCATCACACAGCATTATCTCCATGCTTGTTGCCCTCGAAACCGGCGCGGACAAGGATTCAATTCTGTGCTTCCCCAT
TGTGATGTTGTTCTCGGCCTTCACGGCAGGCTCGACTATCGCCTACTTGTACCTCAAGGGCCTTGCACCGCCCAGCGTCC
GGGAAACAGCGTCGTACATTGTGCGCGACAGCCTGCGCCTGATGAACGACGGTGCCGAGTCATGGCCACTGGTGATGCCC
TGGAACCGCCATTTAACAGTCATGGCCAAGGTCATGCGCGATGTCAACGCCCGTGATGAGCATCCCGACTCGCCTGACGG
ATTGAAGCCGGTTCACGACTCGCCGTACATGAAGGACGACGCCTCGTCGCAACCCGACACGAACCCAGATGCCATGGAGT
ATGAGCAGCAGAACGCAGCTTCGTCTCAGGAAGCCGCCAACTTGACGGAACGAAACAGTGAGCCACCACCGCCGAGACGC
ACTGGCATTGCCACTATTAATGGCGGATCAGCTGGCGCGACCACACCGGCCACAGCCAGCCCCCCTGCGCATCCGGTGGG
GAAGCTGGAGTCTCCCGAGCCGCGAAACTTGTCGCCAAACCCGCCGGGTCCCAGTGTGGACATCAATGCCAAGGAGCTGT
GCAGTGCCTTTGAAAGACAGCTGCTGGAGCTGGACGACCTTGCAGCGTTCATGGGCGGTGGAGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62