GenePrediction:GLEAN_7341 Details

Name: GLEAN_7341
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2657443..2654634 (- strand)
Length: 2810
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2657443..2657435 (- strand)
Length: 9
Type: CDS
Source: GLEAN
Position: GCSC_140:2657358..2657260 (- strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_140:2657205..2655994 (- strand)
Length: 1212
Type: CDS
Source: GLEAN
Position: GCSC_140:2655920..2655188 (- strand)
Length: 733
Type: CDS
Source: GLEAN
Position: GCSC_140:2655113..2655021 (- strand)
Length: 93
Type: CDS
Source: GLEAN
Position: GCSC_140:2654950..2654634 (- strand)
Length: 317
>GLEAN_7341 class=GenePrediction position=GCSC_140:2657443..2654634 (- strand)
ATGGCTTCGGTAAGAACGTGCCCACGAGAAACATCGCTTCATTTTTGGGTTTATTTCTTGCTGGTTTTTTAACATTAGTA
TCTAGGAAAAGACAGACTCGCGCTTTTCTGTTCTGGAGCAGAAGTACATCGACCTCCTGGAAAGAAGAGTGCAAGACCTG
GAGCGAAAACTTGCCGGTGCAGAAGTAAGGACAGACCATAATGATGTGAGAACGGAATGAATAGCTAACATGAACTAGGG
ATCTAAGCAGGTGAACGGAACGGCTTCGTCAAATTCCAAGAAGGCCGAAAAGTTAGAGAAGGAAGAAGATGAATCCTCCG
ATTCCGAATCCGTTTCCGAAGGAGAAACAAAAGATGACGAGGATAAGGAGAAAGACAAAGAGCCTGACGACGACAGGCGC
TATCGTGTGGTCATCAGCGAGTACGACCCAAATACGGGCGAGTATGTCGAACGAGCCAACGAGAGTCTGGTGAAGCCAAC
AACCAAACCCAAGAATTCCAAGAGGGCCTTTACATTCCAGAAGAATCGGAGGCTGGGGGCCATAGCTGGTAATGAATCCC
GTAACTCTGAGGTGGACATTGAGTCGTCACCGCTGCAGCAGTTGTTGGCCAGGGTGATGTCCAAGCTGGACGCTGGCAAG
AGCAAGGTGGCCGACATGAGCTCCCCCTACCAAGATCTCATCTGGTGCTGGAAGGAAGCAGAAGAGATGGCGGCCACGTC
CGCTGAGCTAGAGGAGGCCACCAAGACAGACTTCAAGGACGTTGGTGGTGAAGAGAAGCAGGCCAGGCTGGATCTGCGGG
CTCTCTTGAACATCATCTCGACGTCATCGGGTGATGAGGCCCTCGACACCTACTTCAAAAGCAAGGACGATATGAAGGAT
AGCCGCACCATTTCATTTTCTGCGCTGTGGACGCTATTCCCTCCGGGCTCCTTCATCATTGCCCGTCCGTTCCTCAACCA
CGAGCAGGTCTTCTTGGTACAGTCCTGCGAGATCCCCGACACAAACGACAACGATGCCAAGCTCTCGGTGACTGCGTTCA
GCTACGACTGGAATGGCAACAATTTCCACCGCGTGCCGTACCGCTTTATCATTGAGGAGTTTAAGGATAAGAAAACCATA
TCCCAGCTTGATTTCTACCCCCTAAAGTACTATAGCGAGGGGGACGAAGCCGGCAACGAGCCCCAAGAAAAGAGCGTAGA
AAACATTACTAAAGACGTCGAAAAGCTCAAGGTGAAGCTGATTCAGCGGGGAAAGAAATTTGTCGAGTACTCGACGGCTG
AAAAGGGAAAAAAGACGTTTAACTACGACGGCCGTGCCTTCTACACTAGCAATCATGGTCTCTTCCGTCCAATTTCGACT
GCAGATCCAGGTGACTCGGATACGGCCAGCACGGCAGGAACGACAAACTATGCGTCTTCAGATAGTCAGACAGCAGGAAC
GACAAATCATGTAAGTTAGACAATCGCGTCTTTTTGCAACAGATTTCACTCGCCTATCACGCCTAAGCTAACACCCACGA
CAGATTAAGGGAACCGTTGTTGTCGACTTCAAGTCTTACCTTGAATACCAGCCCGAGTCCGCTGAGCGTCTCGGCTCCAT
GGCCCCGATAGGAAGCTCCGTCACTTGCTCCTGCGGCGAGTGTCGCGCCCGCTTTGAGGCTCTGTACCGCTACTCATGGG
ACAAGGCCAAAAAGGAAACCGCACTGTCGGACGACCAGTATATGATGCTGCCTCCGCGTGTCCTCGGCTATTCTCTCGAG
CAGAAGCGATGGGTACACTTGGACATCGACAGATTGAAGCAGTTGGCCAAGGCCGACAGCAAGAATTTTGATGAGAAGCT
GATGTTGCACGATGACAACAAGAAACTGATCAAAAATTCCGTGAAAGCGCATGGCAGCCAAAACGTGGTGGATTACACGC
CGAACAAGGGCAAGGGACTGATCTTGCTGTTATGGGGCGTGCCGGGAGTGGGCAAGACGCTGACGGCGGAGAGTGTGGCC
ATGCTGGCAGGCAAGCCACTCTTTAGCATTGGCGTGTCGGACATTGGCACGGAGAGCAGCATGGTGGAGGCGAACCTGCA
GCGGGTATTTTCCCTGGCAGGTTTGTGGGAGGCGGTTCTTTTGTTGTATGTGATGGCCAACCGACTATTTATCTTTGGTG
CGACTACTAACGAAAAGAACAGTGATGAGGCAGACGTCTTCTTGGAAGACCGCAGTTCCCAGGGGTCCAACATCCACCGC
AACACCATGGTCTCAGGTAAAGAATTCACCGTGTTGCCCGGCCTTTCTCGAAACGATTTGTTACCTAACCTCGTCTACCA
CACTGCGTAGTGCTCCTCCGCATCTTGGAATACTACGAGGGGATCCTCATTCTGACGACCAACCGCGTCAGGACCTTCGA
CATTGCCGTGCAAAGTCGAATTCGTGAGTTTCTCCATATATTAATAGCAATGCCCTCTCGGCTTGTGCTGACGAACAATT
TAATATTCCCTAGATATCGCCATCGAGTACAAAGAACTCAGCGACGACCAGCGCGAGAACATCTTCATCGACTTCCTCAA
CCAGCTCGTAAGGATGGACATAGTCCAAGACTGGAACGCTATTAAAGAATGGGTCCATCAGGAAGGGCGTATCAAGCAAT
TCAACGGCCGGCAAATTCGCAACACGGTGTACACGGCCATGGGTATGGCCCACGCCGAGGCCCGCAAATTAGAGAGGGCG
GATCTTGTCACGGTGGCACGCAACACAGAGGCATTCAAAAAGGTTTTGTCCGACAACGAGGCAGTGTACAGGAGCAGACA
GATCTTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62