GenePrediction:GLEAN_7342 Details

Name: GLEAN_7342
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2647584..2645377 (- strand)
Length: 2208
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2647584..2647470 (- strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_140:2647397..2647186 (- strand)
Length: 212
Type: CDS
Source: GLEAN
Position: GCSC_140:2647121..2647006 (- strand)
Length: 116
Type: CDS
Source: GLEAN
Position: GCSC_140:2646943..2645377 (- strand)
Length: 1567
>GLEAN_7342 class=GenePrediction position=GCSC_140:2647584..2645377 (- strand)
ATGACTGGTCGAGGCGCGCGCCGCTCAGGCGGCTCTGTCTGGCGCAACCTTCTGGGCTGGAACAAGCACCCGTCCCACGA
ACGCCGGGGCCTCCTGGAAGACACACGCCGGCGTCGTGAGTGTCTCCAGTCCCCCGATGCGGGCAATTGCACATGCACAA
CAAAGTGCTGACCTGTTGTCTCTCCAGTACTTCCCGCATACGTCGAGGACAACATCGAATCGGCAATCCCGCCTGCCGAG
GTTACCAAGATTGCCATCCGGCTCCACCACCTGGTCGAACAGTGCATCCCTTGCGAGATGGAGGAAGAGCTCGTAACACG
CTCACACAGCAAGATCATCAACAAGGCAGTCATCAAAGCAGCGAAAGAAGCCGGCGGTGAGGAGTACAGGGGCTGTGTGG
TGGGTTTCCCACATCCGGAAGAGGGAGCAGCTCAGAGGAGCGAGCAAGTCTGACATACGGCAGGTCTTCTGTCTACTCAT
CTGCAAACGTTGGTTCCGGCACCAGGCTCTTGCCGAGCTCTGGGACGCGAGCATGCACCAGGTGCGTGGCATTGCGTGCG
AGGTGATTGCCAAGCAAATGTAGGTCCAGACTCTCTCTCGACCCCGGCTCTTGTCAGTGGGTAGGCACCTAATGCGGGCA
GCATCGAGAACGAGGAAGATACCGAGTACCTGATGCACTCGGTCCTTTTAAAGCGCTACGCCATCCTGATCGACCAGGAG
CCGACGCTGCCATCCAACGTGATTGAAAAGGCAGTAGACCTGCATGCGCTGCGTGTGATCGGGTCATCGGGTTACCAGAA
GTGCATTGGGTACCTGTGGCGCGGCTGGTTGGTGCAGGATGAGGACGACCCGTCGAACTTTGTGGACTACAAAGGGCGCG
ACGACACGTCGTTTCTGTCGCACATGGATCCGGACCGGATGCGGGCGCCGATGTACCAGAACGCGGCGCAGATGCTGCTC
TCGCTCATCTACCTTGGACTCTTCACGATTGCGATCAACACGATCAACCGGAGCGGCGACTTGGACTTTGTGGAGGTCGT
GCTGTACCTCTTTACGTTTGGCTTTCTGTTTGACGAGATTTCCAAGATCTGGAAGGCAGGCTACTACATCCTCGGGTTCT
GGGATGCGTTCAACGGGTTGCTGTACTCGCTGCTGCTTACCAGCCTGGCACTGCGGTTTGTGGCATTCAGCAAGCCGTCG
ACGGGCGATGTGAACTTCAAGGGCCCGCGCGAGCACTACAACGAGCTGAGCTACAACTTCCTGGCCTTCAGCGCGCCTAT
GTTCTGGATACGGCTGCTGCTGTACCTCGACAGCTTCCGGTTCTTCGGGGCGATGCTGGTGGTGCTCAAGGTGATGATGA
AGGAATCAGTGATCTTCTTTGCGCTGCTGATCGTGATCCTGGTGGGTTTCCTTCAGTCGTTCATCGGGCTGGATATTGCA
GAGGACCACGTGCTCGGTGACATTGGATTTATCGTGCAGGCGATGGCCAACGCAGTGATGCAGAGCCCCGACTTTGAGGG
CTTTGAGCAGTTTGGCCATCCGTTCGGCATCATCCTGTACTACTGCTTCACGTTTATCGTGATGGTGGTGCTGCTCAACA
TTCTGATTGCGCTGTACAACTCAGCCTACGAGGACATTTACGAGAACGCGGACGACGAGTATCTAGCGCTGTTTGCGCAG
AAGACGATGCAGTTTGTGCGGGCGCCGGACGAGAACGTGTTTATCCCGCCGCTGAACCTGATTGAGATTTTCTGTCTAGC
GCTGCCGTTTGAGTGGTGGATGAGCAAGCGGACATACGAGAAGCTGAACGACTACGTGATGGCGGCGCTGTACTCGCCGC
TGCTGGTGCTGGCGGCGTACTTTGAGACGCGGCAGGCACGCGAGATCCAGGTGAACCGGCTGCGCGGCGACGCGGACGAC
GACATTGTGGAGGAGTGGGAACAGCTGGGACTGGGGCTGGGCGGCGATGCGGCCGGCACGATGACGGTCGACTTTGAGGC
TGACGGCTGGAACAAGACGGTCGAGCGGGTGCGGCCGAACGTGGAGGACGAGCTGGCGGTGTTGGAGGTGCGCGAGCTGC
GGTCGGAGGTGGCGGAGCTGAAGCTGATGCTGACGGCCCTAACCAGATCGCTGGGGACGTCGGCCGTGCCGCAGCTGAAG
GCTGGGGAGAGCTCCAAGACGGCCGAGACACTGGTGGATACAGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62