GenePrediction:GLEAN_7343 Details

Name: GLEAN_7343
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2642224..2641297 (- strand)
Length: 928
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2642224..2642066 (- strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_140:2642013..2641297 (- strand)
Length: 717
>GLEAN_7343 class=GenePrediction position=GCSC_140:2642224..2641297 (- strand)
ATGATGAAGCTCGCACCGTCGCTCAAGGCGCTCATCAACGCGCCGCATTCGCGGCCGGGCCCGACATCGGCGCCGGCACA
CATTGCCGAGGTATACCGGGCAGTGGCACGTGACGCGGCCAAGCACAACGTGGGCAACCAGCCATGGATCACGATTTCGG
TGAGTATGTGGGAGGACGAGCTCGTTCCAGCACGACGCTGACCGCGGGCAGGCGGCGGCAACGATCACGCTGAACTCGCC
GGCGTCGCTGTCGGTGCTGCACGGCGTGGCAACCGACGAGACGACGGCATCGGCGAGCGGCAGGTCTGAGAATCCCATCG
CGGCGGCCGAGCTGATCCGCGAGGTCGGGCTCAAGTGCATCGGCTTCAACGGGATCCCGCGCACGATCAACGTGCTGGGG
GCATTCCGGACGGCGCTGTCGGCGGACGTGGTGGCCGGACTGGCGACGCAGAGCACGCGGACGCCGACCCCTGAAACGCT
GGCGGCCATCAGCGCGCGCGGGCTGACGCTCTGGCGATCCGTCTACGCTGGCGTCGACCAGAAGCTGCTCGACAAGCTGG
CCGAGTCGCATCCGGACCTGCCGGTGCACATTCTCAACTCGCACTACGGCCCCCTCTTCACCGATCCGCCGCACCACGGC
GACGGTGGCCTCGCCAACGTCGGACGCGCCCTCACAAGCCTCGTCGGTATCACGTGTCTGCGTGCTCAGCAGGGCGTTGG
CCCCCAGGTGCTCTCGCACGTCTTCGGCCTCCGCAAGGCCATCGCTGACGGCTCCTGGAAGCCGGCCGGCACCGGCGCCG
ACGCCCTCGAGCAGGTCCGCGGTGTCGACTGGCTCGCCACCGACGACGGAAGCGAGTGGATTTTGCGCACCGTCGACACC
ATCGTCGATGCCCTCGGCGGCTCCAACTTTGCCGGTGCGAAACTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62