GenePrediction:GLEAN_7344 Details

Name: GLEAN_7344
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2640176..2639835 (- strand)
Length: 342
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2640176..2639835 (- strand)
Length: 342
>GLEAN_7344 class=GenePrediction position=GCSC_140:2640176..2639835 (- strand)
ATGCTCTTGTCCTGGGTCTCAAAGTACATTCCGGCCATCGCGGCTATTGGCGCCTTTGCCAGTCCGTTCGTCCATGATCG
CGGCTCTCTCCTCCCTGGTTCCCCCAACTGCACCTCGACCCAACACATCCTCGGCAAGTTCACTGCCGGACCTGTTTGCA
CCATCTGGACTGCCACCACCGCCACCACTGTCCACATTGACTGCAGCGGATGTCGCTTCCTTGCTACTGAGACCTTGGGC
TACGGCCGTGGTCACGGCCCCGTCGTCCACTTCAGCACCACCACTGCTGCTGCCACGCCGCGCACGACTACCACCTACCT
TTGCCGGCCGTACTCGTCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62