GenePrediction:GLEAN_7345 Details

Name: GLEAN_7345
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2631785..2625865 (- strand)
Length: 5921
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2631785..2630409 (- strand)
Length: 1377
Type: CDS
Source: GLEAN
Position: GCSC_140:2630343..2625865 (- strand)
Length: 4479
>GLEAN_7345 class=GenePrediction position=GCSC_140:2631785..2625865 (- strand)
ATGAGCTCACTCTCGCTCAAATTCGTCTCCTCGTCCCTGGGCGTCATCGCCGCGTCCAAGGATGCCCACCACAATGCCGC
CCTCGGTGATGCCGTCAAAAATGCACTCGACGCCATCAAGGCCGCCGATCCCGAGTTGCCCGACCCCGAGATCGTCTTCG
CTCCGCTGCAGCTGGCCACGCGGTCCGGCAATATTGCTCTGGCCACCAGCGCGCTCGACTGCATCGGCAAACTCATCTCC
TACTCGTGCTTCTCCATCCCACCACCTCCGTCGTCATCGTCCGAGCAGGGCTCGCAGGCCTCCGACCATCCGCCTCAGCC
GCCCAAACCGCCAGCTGCTCCTTTGATCGAGCGCTCCATCGATACCATCTGCGACTGCTTCCAGGGCGAGACTACACCGG
TCGAGATCCAGCTGCAGATTGTCAAGTCGCTGTTGGCTGCCGTCCTCAACGACAAGATCGTCGTGCACGGCGCCGGCCTG
CTCAAGGCCATCCGCCAGGTCTACAACGTCTTCCTGCTGTCGCGCAACACGGCCAACCAGCACGTTGCCCAGGGCACCCT
GACCCAGATGGTCGGCACCGTCTTTGAGCGCGTCAAGACCCGCCTGCACATGAAGGAGACCCGTCTGGGCCTGGCGAAGC
TGAAGCAGAACGGCAGCAACGCCACCTTTGAGCAGGCCGAATTGTCCACCAACGGCGCCGGTACCGACAGCAGTCGCAGC
GGTGCCGGCAGTGCGGACGGTGACGACAACGGCGAGGCTGATGGCGAGGACGATGACCATCGGCTTCCGCAGCTGCCGAC
GGCCGAAGTCGACGAGGCTAGCGATGCTGCGGCCAAGCTGACGCTCAAGGACCTCGAACACCGCAAGAGCTTCGACGACT
CCAATCTGGGCGATGGACCGACCATGGTCACCCATCTGAAGCATCCACCAGTGCCGTCTGCCCGCTCTGTGTCTGAGCAG
GCCGCACCCGACAGTCCCCACGGCGACTCGCCTGAGTCGCTCGACGCCGAGGACGAGGTCTACGTCCGCGACGCCTACCT
CGTCTTCCGCTCTTTCTGCAACCTCTCGACAAAGGTGCTGCCACCCGATCAGCTGTACGATCTGCGCGGCCAGCCGATGC
GGTCCAAGCTGATCTCGCTGCACCTGATCCACACGCTGCTCAACAACAACATCGCCGTCTTCATGTCGCCGCTCTGCACC
ATCACCAACACCAAGAACAATGAGCCGACTAGCTTCCTGCAGGCCGTCAAGTTCTATCTCTGCCTCAGCATCACACGCAA
CGGCGCCAGCTCTGTCGACCGCGTCTTCGAGGTCTGCTCCGAGATCTTCTGGCTGATGTTCAAGTTCATGCGGCCGCCCT
TTAAGAAGGAGATTGAGGTGTTCCTCAACGAGATCTACCTCGCCCTGCTCGCGCGCAAGACCGCCCCGCCGTCGCGACGA
AGCTGTATTTTGTCGGCATCCTTAACCGGCTCTGCGCCGATCCACGCGCCCTTGTCGAGACGTACCTCAACTACGACTGT
GACCGCAACGTCGACAACATCTTCCAGACCATTGTCGAGTACCTGGCCAAGTTTGTCATCACGCCCGTGTACGTCGCGCC
CGAGCTCGAGCGCGGCTACGAGGAGAAGCACGGCACGACCAGCGGCAGCGACTGGCAGCTCAAGACCACTATGCCGCCGC
CGCTGACCGTCAACCAGATCGTGCCGCACCATGAGCCCGAGAGCGAGTTCCCCAAGGAGTACGTGCTGAAGCGCGTCGCG
CTCGACTCGCTCGTCGAGTCGCTGCACTCCATGGTCAACTGGTCGCAGGCCGGCCGGCCTGACCGCAGCAGCGCCTCGGC
GGCCGACGTCGAGAAGCGCTCGTCGACCGAGGACATGCGCGAGTCCATCGACCCATTGGCCAGCGACAGTGTCTCGCGCG
TGGACGCGTCGCCCATCCCACCATCCACACCCGTTGTCGACGATGACCCGGAGCACTTGGAGAAGGAAAAGGCCCGCAAG
ACTGCCCTGGCTGCGGCTGTGCGGGCGTTCAACTTCAAGCCCAAGAAGGGTATCAAGATGCTGATCGAGCAGGGCTTCAT
CCCCAGCGACTCGCCCGCCGACATTGCCCGCTTTCTGATCCGCGACGAGCGCCTTGACAAGGCGCAGGTCGGCGAGTATC
TCGGCGAGGGCGACGCCAAGAACATTGAGATCATGCACGCCTTTGTCGATACCATGGACTTTAGCAAGCGCCGCTTTGTT
GAGTCGCTGCGCCAGTTCTTGCAGTCGTTCCGGCTGCCGGGCGAGGCCCAGAAGATCGATCGGTTCATGCTCAAATTTGC
CGAGCGCTACAACGACGGCAACCCGAACGCATTTGCCAACGCGGACACGGCGTACGTGCTCGCATACTCGGTCATCCTGC
TCAACACGGACCTGCACAGCAACAATGTGACTAAGCGGATGAGTAAGCCGGATTTTATTCGCAACAACCGCGGCATCAAT
GACAACGCCGACCTGCCGGAGGAGTACCTGCTGGGCATCTATGACGAGATCGCGTCCAACGAGATTGTGCTCAACAGTGA
GCGGGCGACGGCGGCGGCAGCTGGCGCGCTGCCATCGCAGCCGACGGGCCTGGCAGCGGCCTTTTCCAACGTCGGCCGCG
ACCTGCAGCGCGAGGCGTATGTGCAACAGTCAGAGGAGATGGCGCTGCGGTCGGAGCAACTGTTCAAGAACCTGTACCGC
AGCCAGCGGCGCAACACAGCCAAGACGGGCATCAAGTTCATGCCGGCGACGTCGTTTAAGCACATCGGTCCCATGTTTGA
CGTCACCTGGATGTCGTACTTCTCCGCCTTTTCGAGCCAGATGCAGAACGCGCACAACCTGGAGCTGAACCGGCTCTGCC
TCGAAGGCATGAAGCTGGCGGTCAAGATTGCGTGTCTGTTTGAGCTGGCGACACCGCGCGAGGCCTTCATCTCGGCGCTT
CGCAACGCGGCCAACCTGAACAACGTGCAGGAGATGTACGCCAAGAACGTCGAGGCGCTGCGGGTGCTGCTGGAGCTGGG
CCACACCGAGGGCAACTACCTGCGCGAGTCGTGGAAGGACATCCTGATGTCGGTCAGCCAGCTGGAGCGGCTGCAGCTGA
TGGCCGGCGGCATCGACGGCAGTTCGGTGCCAGACGTGTCCAAGGCGCGCTTTGTGCCACCTTCGAGCGCAAGCGCTCGC
GAGAGCAGCAGCACTACTAGCGGGATGGACCAGCAGCGGCGGTCGATGCAGCGGCGGTCGCGGGCGATGACCACGGGGCC
CAGCGGGTTCTCGTCGGCGGACGTGGCGTTTGAGCTGACGTCGGACGAGACGCTCAAGAGCATGGACCGGATCTTCACCA
ACACGGCGAATCTGCACGGTGACGCTATCGTGCAGTTTGCCCGAGCACTGACCGAGGTCAGCTGGGATGAGATCAAGGTG
TCGGGATCCAACGAAAATCCGCGCATGTACAGCCTGCAGAAGATTGTGGAGATCAGCTACTACAACATGACGCGGGTTCG
TTTCGAGTGGACCAACATCTGGGACGTGCTGGCTGACCACTTCAACAAGGTGGGCTGCCACGGCAACGAGGCGATTGTGT
TCTTCGCGCTGGATTCGCTGCGGCAGCTATCGATGCGCTTCATGGAGATCGAGGAGCTGCCGGGCTTCAAGTTCCAAAAG
GACTTTCTGAAGCCATTTGAGCACGTCATGTCCAACTCGAGCAACATCCACGTCAAGGACATGGCGCTGCGCTGTCTGAT
CCAGATGATCCAGGCGCGCGGCGGCAATATCCGGTCGGGCTGGCGGACCATGTTTGGGGCCTTTACGGTGGCGGCACGGG
ATCCGGCAGAAAGCATCGTGAACATGGCATTTGAGAACGTGACGCAGGTGTACCGGACGCGCTTCGGCGTGGTGATCCAG
CAGGGCGCGTTCACGGACCTGATCGTGTGTCTGACCGAGTTTTCCAAGAACATCCGGTTCCAGAAGAAGAGCCTGCAGGC
GATGGAGACGCTCAAGTCAGTGATCCCGACGATGCTGAAAACGCCCGAGTGCCCACTGTCGCAGCAGAAGAAGAAGGCCA
AGACGAACGGCAGCAGCAGCGGCAGCAACGGCACGACCGGACCGGCGGCTGGTAGCGAGGGGGTCGTTCCAACAGTGACG
GTGGTGCAGAACCGGACATCGGTCGAGGAGGGCTACTGGTTCCCGGTGCTGTTTGCGTTCCACGACGTGCTGATGACAGG
CGAAGACCTGGAGGTGCGGTCCAACGCGCTCAACTACTTCTTCGAGACGTTGCTGCGATACGGCGGCGGGTTCCCGCCCG
ACTTCTGGGACATCCTTTGGCGACAGCAGCTGTACCCCATCTTCATGGTGTTGCGGTCGCGGCCGGAGATGTCGAACGTG
CTGAACCACGAGGAGCTGTCGGTGTGGCTGTCGACGACGATGATCCAGGCGCTGCGCAACATGATCACGCTCTTCACGCA
CTACTTTGACGCGCTGGAGTATATGTTGGACCGATTCCTAGAGCTGCTGGCGCTCTGCATCCTGCAGGAGAACGACACCA
TTGCGCGCATCGGCAGCAACTGTCTGCAGCAGCTGATCCTGCAGAACGTCGCCAAGTTCTCGCCGGCGCACTGGTCCAAG
ATCGTCGGTGCCTTCTGCGAGCTGTTTGAGCGCACGACGGCGTACCAACTCTTCTCGGCCACCACGGCGGCCGGCGCTGG
TTCGGCGGCCGCTGCATCGGCATCGCTGTCGGCCGCGCCGGGTGCGCTAGAGCTAGGGTATCCGTTGAGTCCGGTGCCGC
CAGGGGTGGCGTCCTCGTTTGGCGATGACAAGGGGCTGGGCCTCAACGGGGAAAGCAGTGTTGGCGGTGGGGGTCTATCG
GCGAGAGCAGACTCAGACACGGCATCAATGTTATCGGTGGTGCCGACAGAGGCGACGACAGAAGAAGATGTGCAGCGGAC
ACCGACGTCGGCCACGACGGCCACGACAGCCACGACAGCCACGACAGCCACGACAGCCACGACAGCCACAACAGCCACAA
CAGCAACAGCCCCGCTAGAGGACTACCGGCCATCGAGCAACCTGCAGCAGCAGCCGGTTGTGGTAACGGCGGCACGGCGG
CGGTTTTTCAACCGGATCATCTCGCGTTGCGTGCTGCAGCTGTTGATGATCGAGACGGTCAACGAGCTGTTTGGAAACGA
GGCGGTATACCGACAGATTCCGTCGGTGGAGCTGCTGCGGCTGATGGGGCTGCTGAAGAAGTCGTTTTTGTTCGCGCGGC
GCTTCAACACGGACAAGGAGCTGCGGATGCGGCTGTGGCGCGAGGGCTTCATGAAGCAGCCGCCGAACCTGTTGAAGCAG
GAGTCTGGCTCGGCGGCCACGTATGTGGCGATCCTGTTCAAGATGTATGCCGACGGGGCGCCAGAGCGACAAGCGACGCG
GGCCGACGTGGAGAAGGCGCTGGTGCCGCTCTGCAAGGACATCATGCACGGCTACCTTGCGCTCGAGGACGAGAGCCAGC
ACCGGAACATCATGGCGTGGCGGCCGGTTGTCGTCGACGTGCTCGAGGGTTTTGCGCTGTTCCCCGAGCCGGCCTTCACG
GCCCACACGCGCGACTTTTATCCAGCCGTGGTGGCGCTGCTGGCCAAGGAGCTGAGCGGTGAGCTGCGCGCGGCCATCAT
CCAGGTGCTTCGCCGTGTCGGAGAGGTTGGGCTCGGCATCGACGGCCTCGCGTCCGCGCCCGACGGCTTCTTTTTCGGTG
GCCAGCGCCGCGACAGTTTGCTGAGCGCGGCCAGCGCCGAGGGCGGCGTCGGTGGCGGCGTTGGTGGCGGCAGCTCGGTC
GACGACGAGGGCGGCGATGCCAGCACAAAACTGATGGGCCGGCGGATGCACTCGCCGCCTGTTTCGGGGGGGCTGAAGTA
G

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62