GenePrediction:GLEAN_7346 Details

Name: GLEAN_7346
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2623917..2622996 (- strand)
Length: 922
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2623917..2623801 (- strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_140:2623733..2622996 (- strand)
Length: 738
>GLEAN_7346 class=GenePrediction position=GCSC_140:2623917..2622996 (- strand)
ATGTCCAGAGGCGGCCGTGGTGGTGGTCGTGGCGGCAGACGTGGCGGCGGCCTGGGTCTGCCCTGGGGCGACGACCCGAG
CATGAAGGCTGACAGCAAGCCGGTCGAGCTGTTTCCGGTGGGTTTTGGTCTTTTTGTTCTCTCTTCTCTGTCCTTTCTCT
CTGCGCCTCTCACTGACCTGTCAGCCCTTTTCTGTTCCGACGGCGGCCCCCTTGGCCCCCCAGGAGCGCCAGGTGGTCGA
CCGCTTCCTCCTCATGCGCGAGCAGATCCACTCGAGCCCGCTCTATACGCAGACACGCATCCGGAAGGACGGCGACGGCG
ACGGCGATGGTTCCGGCAAGGCCTACGGCCAGGACCAGATCAACCGCCAGTACGGCATCCGCACCAAGGCCACCCTAGAC
CCTTTCACGGCCGTGCCGCTGTACTCGCACCGCTTCGAGAAGCAGGACCGCGTGCTGCCCGATCTGACCGGTCGGCCCTT
TAGCAAGGAGCTCTTCCCGCCCGAGCTGTGGCCCACGCTCGACGGCATCGATGACGGTCGTCGTCTCGTGCGCGGCAGCC
ACACGCGGCGGTCCCTTGGCGGTGCACAGGCCGGTCGCCGCACTCTCGCCCTATCCGAGGTCACGACCCTGCGCACGGCC
GAGGAGATCTTCCAGCGACGGAGCGCCGCCGGTGGTGATGACGACACGCGCAAGGCGCTCGAGCAGCTGGAAAAGTTCAA
GAACGTCGGGCTCGACAACGAGGACAATGTCGAGTTCGAGCTGGTCGAGGACGAGGGCGACTACGATGAGGTCGAGGACG
AGGCCTATGACGACGACGAGGAGGGCGACTACAACGCCGAAGCTGCCTTTGACAACGGCGACGACGACGACTACGGCGAC
GACTTTGGCGACGGCGGCGGTGGCGACGACGGCGTGTATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62