GenePrediction:GLEAN_7347 Details

Name: GLEAN_7347
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2620735..2619382 (- strand)
Length: 1354
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2620735..2620538 (- strand)
Length: 198
Type: CDS
Source: GLEAN
Position: GCSC_140:2620474..2620422 (- strand)
Length: 53
Type: CDS
Source: GLEAN
Position: GCSC_140:2620348..2619382 (- strand)
Length: 967
>GLEAN_7347 class=GenePrediction position=GCSC_140:2620735..2619382 (- strand)
ATGGACATTGACGAGGACGACGATTTCTACGCGCCAGAAGAGGCAGACATTGACACAGCAGCTCCGGCGCAATCGGCACC
ACCAGCCGCACCTCCGTCGACCTCCACTGCAGCAGTAGACCAGAGCGGCAGGGATGATTTGGAAGAGGGCGAGGAAGAGG
ACGAAGTCGGGGCTGTGGAGGACGAAGAGGAGGACTCGGTGAGCAGCGGCCACTGTTGAGACAGTTGCAGAAGGACACAT
CCTCTGACCAGATCGATGCAGGATATCGACATCATAATAGAGCGGAAAGACGGCTCCAAGGCCGCACCTCCTTCGTGCGT
CACACTTCCTGTTCATAACGGTATACATTCAGGCAGACAGACTGACAGTGCCTTGCAGACAAGCCAGATACAGCGACATT
CGCAATATACGTGACGGCAGCGGCAAGGCGACCGTGGGAGCGAAGAAGGACGACAGCACAGCCACAAGCGGTGGCGGCAG
TGGTGGCGGCAACAGCGGGACAGCCACTGGCTCCAGTGCGACCGCTGGTGCCCGGGGTAACGAGTACCCTGCAGTGCCGA
CATCACTGATCGACGTGAACGCAGTGCCAGTGCACAAGGGCACGGGCAAGCGGATCACGCAGGTCAACATTGACGAGGAC
CTGCCGGAGAACGACAAGCCATGGCGCAAGCCGGGAACGGATCTGAGCGACTACTTCAACTACGGCTTCGACGAGTTCAC
CTGGGCCCTGTACGCCCAGAAGCAGGAGGCCCTGCGCGGCGAGTACAGCCAGGACGCCGTGGCCGAGAAGAACAAGAAGA
TGATGGAGGACATCAACAGCATGTTCATGATGGGCGGCATGCCGGGCGGTGGCATGCCGGGAGCCGGAATGCCAGGAGGA
ATGCCTGGTGGCATGTCAAGCATGGGCATGCCAGGTGGTGGGCCAGGGGGGCCTGGAGGGCCAGGAGGTCCAGGCGGGAG
CGGCGTGCCGTCCGGGGGAGCAGTGTCTGGTGGTGCAGGCGCAGGCGGAGGACCGGGTGGTCCAGGGGTGGGGGCCATGG
GTGGTGGTGTCGCTGCTGGAGGGCCTGCAGTGCCCGGTCTCGACGGCATGCCGCCGGAGATGCAGCAGATGATGCAGCAG
ATGCTCGCGTCCGGCATCGATCCCAGCCAGATGGATCCGGCCACCATGGCCAACATGATGGCGGCTGCTGGCGGCGGCGG
TGGTGCTGGTGGTGGCGGTGGCGGCTACGGCAACCAGGGCTTCGGTGCTGGCCAGGGTCAAGGCTACGGCGGATACGATC
CCAACATGGGTGCCGGGAATGGCGGCCGTGGCGGTGGCTTCGGACGGGGGCGCGGTGGCCGGCGAAACTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62