GenePrediction:GLEAN_7349 Details

Name: GLEAN_7349
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2612117..2611233 (- strand)
Length: 885
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2612117..2612115 (- strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_140:2612027..2611233 (- strand)
Length: 795
>GLEAN_7349 class=GenePrediction position=GCSC_140:2612117..2611233 (- strand)
ATGGTATGTTCTCCGCCAGTAGGCCTCGTACCTTGCGCGCGCTCAGCAGTGGCTGCAGATGTCCTCCTAACCGCCTTCTA
AACGCGACAGAACACTGCATTTAACGGCGCGCTCAAGCAGAGCACAGCCATCCGGAAGGACCTGTCCTCGCTGTCAGCAG
TGCTGTCCAACCCGTCCGCAGACGATGGAGCTCTGGTCCGCATGCCAGCAGCCTTCGGCCAGCTCTCTGCCAGCCTGACG
ACGTTCTCGCGAACCGTCGACGAATACAACAGCCTAGCGAAGCAGGAGCTAAATCCGGCAAAACAGGAAAAGGCCTTTGA
CCGCATCCGGAACTTTCGCACCGAGCTGGGCGAGTACCGCACACAGCTGGAGAGCCTCAAATCATCACGAGACGATGCCG
TACAAGCACAGAGCCGCGCCGAGCTGCTAGGGCGCCGGCCGTACGTCACAGCAACGCCCGAGAATCCATACGCGTCCGCG
GCAACAGCAGCAGCAGCATCAGCAGGCGGGGGCGGGCCAGCGTCGTCGAGCATAGCAGGGGCCGCGGGGCTCTTTGGACA
CGCGCGGACGATGAGCGCGAGCGAGCGGGCAGAAATCACGCGCGAAACACATGCGCTGCGGGAGCAGAATTTCTTTTCGA
ATACCAACACGGCACTGGACGAATACATTGCCCGGGGACAGGCTGTGCTCGGAGACCTGGGCAGTCAGCGGGACATGCTG
AAGAACACGCAGAAGCGCATGTACACAGTGGCGAACACGCTGGGCATCAGCGGCGACACGATCCGCATGATCGAGCGGCG
GGCGCGGGAGGACAAATGGATTTTCTGGACCGGTGTCGTCATCTTTGTGCTCTTCTGCTGGTTGTGCCTCCATTATTTGA
GGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62