GenePrediction:GLEAN_734 Details

Name: GLEAN_734
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1728017..1728958 (+ strand)
Length: 942
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1728017..1728544 (+ strand)
Length: 528
Type: CDS
Source: GLEAN
Position: GCSC_97:1728632..1728688 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_97:1728767..1728958 (+ strand)
Length: 192
>GLEAN_734 class=GenePrediction position=GCSC_97:1728017..1728958 (+ strand)
ATGGCGTCGTTGAGCAGCAGTACCACCATCACGACCGTTTCTGCCTCCGCCGTCTCGGATGACCACGATCTGCCGGTGCC
CCCGTCTCTCGTGCCGGCCCAGTGGCAGGACACCGTGCGGGTCATCGGCATGTCGGAGTGTCGCGAGGCCGCTCTGTCGC
TGTCGCACGCCTTTGCCGCCGATGCCTTGTCGCTGTACCTGGTCCCGTCCGCGGACGAGGAGCGAGGTCCTGGTCTTGGT
CGTGGCCGCGGTCGCGGTGGCCGGCTTCACTCAGCCGAGGACCGCTGGCGGCTGCACGTCAACATCATGACCTACATCGT
GGCGTCGGTGGCACTCAACGGCATCGTCACCACCATCGGCCCCGACTACGATGGCGTGGCACTCTGGCTGGGCCCCGGCC
AAAGCGTCGATGGCTGGTGGACAAGCCTGCGCAGCGGCCTTTGGCGTCTGCACCTCCAGCTGTCGCCCGAGGGCCACCGA
CGCTACTACGACGAGCTGATGCCGCTGCTGCACCAGACCAAGATCGAGGTCATGGGCGGTGGCAGCGGCAGCAGCAGCGG
CAGCAGCTCCAAACACGCTGACAACAGCTACTACCTGCTGTATCTGGGGACGAAGCCCAGCGCCCGACGTCGCGGCTACG
CCCAAAAGCTGCTCGAACACGTGTTTGTCAAGGTGAGAGAGGCGGACCGACGGAGAAGAAGTCTGGGAACGAAAGCAAGC
GTGGGTCTTTGTGCTAATCCGATTGCCAAGGCCGATGCAGAAAAACGCCCGATCTACCTCGAGTCGAGCTCCGCGACCAA
CAACCGGTTCTACAGCAAGTTCGGCTTCGAATACAAAAAGGACATCTCCCTCGTCCGCGGAAAAACGCCAGTCGGCCTTT
CCATCATGGTTCGTGGGCCGCAGACGGCCATCAGCAAGAAGCTCAGCGTTGAGCACGTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62