GenePrediction:GLEAN_7350 Details

Name: GLEAN_7350
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2609609..2608448 (- strand)
Length: 1162
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2609609..2609402 (- strand)
Length: 208
Type: CDS
Source: GLEAN
Position: GCSC_140:2609335..2608951 (- strand)
Length: 385
Type: CDS
Source: GLEAN
Position: GCSC_140:2608883..2608448 (- strand)
Length: 436
>GLEAN_7350 class=GenePrediction position=GCSC_140:2609609..2608448 (- strand)
ATGTATCGCGCCGCGCTCCGCACGTCCACCTCCAGCATCGCCCGGGCAGCTCGCCAACCGGCTCTTGCCGGGGCTGCGAG
GCGCATGCTCACGACCGCTCCTGCAAGTGGCAAGTCCACCTGGAAGGGTTCGTTTGCGCGATGGGGCGTTGCCATCGGCG
CCCTTTACTGGTACAACACCAGCCCCATATTCGCCGATGAGGCTACCAGTATGTCCATTCTGCGCTGTTTTCTGGTGTAT
CGTTAACGAACTCAAACTGACACCACTTGCCAAGACCAAATCATTTCTGCAGCGCCTGAAGTCCCCGAAACCGAGATCCG
GAGCATTGATGCTGTCCTCGAAGAGAAGCGCAGACAAGAGGCCGAAAAGGCGGAGAAGCTGGCGAGAGAATTGAAGAAGA
GCGAACCGGTCACAGAAGATGGCGCTGCGGCTCCTTCTGATGCCGGCGAGATTGTCGGCTCCCAGTCACCCGAAGCCCTG
GAGGAAGAGGCTGGCCAGCAGGGTGCCTTTAACCCGGAGACGGGCGAAATCAACTGGGACTGCCCGTGCCTCGGTGGCAT
GGCTCACGGGCCGTGTGGAGAGGATTTCAAGGCGGCTTTCAGCTGCTTTGTGTACTCGGAGCAAGAACCTAAGGGCATGG
ACTGCATTGACAAGTTCCAGTAGGTTTTATCTACTTTTTTTGCGCTCCCATCGGTTGACGTCCTCCGGCTAACGTGGCAT
CTCTAGGCACATGCAGGACTGCTTCAGACAACACCCCGATATCTACGGCGCAGAGATAGCAGATGATAAGCAGGAGGTTG
ATGCGCAGACACCGGTGCCTGCTGAAGAAGGCGCTGTGGCCGCTATCGAGACGAGCGAGCCGGTGCCTGCGGTCGCGAGT
AACACAACACCGGCGGCACCAGCGACCCCGACGGCCACCGAGAAGGTGAAGAGCGCGGCACCGGCAGAAGCAGCAGCAGA
AAAAGCGCCAGAGACTCCTGCTGTCGTGGCGACAGTGCCGGAGACTGTCAAGCCCAGCGCCAGCAAGCCGGTCCAGAGTG
CCTCCCCGGCAGCATCAAAGGCAGCGCCAAAGAAGGTCGCACAGAAAAAGCCAGAGGATACCTTTGTTGAAGACCCTCAT
GTTCCACAGGCTGCATTTGATGCGACAGCGGCCAACAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62