GenePrediction:GLEAN_7351 Details

Name: GLEAN_7351
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2607257..2600264 (- strand)
Length: 6994
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2607257..2607021 (- strand)
Length: 237
Type: CDS
Source: GLEAN
Position: GCSC_140:2606739..2606415 (- strand)
Length: 325
Type: CDS
Source: GLEAN
Position: GCSC_140:2606346..2600360 (- strand)
Length: 5987
Type: CDS
Source: GLEAN
Position: GCSC_140:2600302..2600264 (- strand)
Length: 39
>GLEAN_7351 class=GenePrediction position=GCSC_140:2607257..2600264 (- strand)
ATGGTCCCACCACCCAGAGCAGGAACGTTTTCTCCGAACCCTGCCCAATCCCTACAAACGGGCGGCAGTCATTCACCTCA
TCCCTCACAGACCGCAGGCTTGAGCGCGAGCCCAATCACCGGCAGCCCTACCGGTACGACGTCCGTCTCCAAGATCGTCA
TCGCCCAGGTGTTTGTTCTTCTGAGCAGCATCAAGGAGGAAAAGGACGACTCTTCAAAGTGGGAACAACTCAGAAAGGTC
AGTCACGTTCTTGCCTTTAGGAATTCCACGCAGGCAATGCGAACTTCCTCTCGTTGTTGCCTGTCAAGTCGCAGCATTTC
CTTCGGCTTGGCGCTACCCTCCCTGTCCTTGCACTACCTCCCAGGAAGCTTCATGTGCTTGCTTACGTTTCCAATGTTTG
CTATATCTGTTTCTGTTACACCTCCTGCTCAGCTTCGTCCGGGGCTCACATTCTCACAAAATTTCCCTGTCGCTGGCCCT
CGGCCGCGGGGCCCTCGGTGCTAACCGTTGTTCTGCAGCTTATCGATGAGTCCGGCATGGAAGTGTTCACAAAGTACTTC
GCTCGTCTCGTAGCTAGTAGTGCTTCCCAAATATTCCCTGGCCTTAACAGGCCAGGGGGTACTCCGGGAACCTACCAGCT
CTTGACAGCTGAAATGCAGAAGATATCACACGAACCTGAGCAGGCCCGCAGGATCGCCGAATCTATCGAGGCTGGTACTG
AGGATATCTTCCGGGACTTCGATCTGTCGACTTTTATGGAGTATTTCAAACTAGATGCTTTAGAGAAGACCATACTAGCT
CTGGCCTTCAAGCTGGGCCCCCGCTCTGACCTGAAGACCAAGGGTGAGTTCCTCGGCATATGCCGTGGCTTTCTCTTGTG
TGTGTCTCGCTAACCGGCACTCTGATAATAGCGGATGCCATCCTTTCCAGAAATTTTTCCGCTTTTGTCAACATCCTGGC
CAAACCAGATGGTGATCATGAAGACCTTGGACCAGAGTTTGTCTCTGTCATTGTCGACCGCTTCATACAGCTACATCCTC
CCAATTTCAACGGCGCCGCCAAGTCAGAGCTTATGTTCAAAGTCACCCAGCGCTACGAACGTGTCGACCTCGGACCTCCG
CCTGAGGCCCTGGCTGCTCTGGATCTGATGCGTGTTTTGGTCGATAAGCCGGCCAACATTCTAGCCCTCCATATGCACAA
GACCGGAGCAGACTTCGCCCGAGACGAGGACACGTGCGTATCGTATTTGCAGAACCGGGCGCTTGCTGGCATTGGCGAAG
AGGCGGTATCGGTTGCCTTGACATACTCGGCTGTCAGCCAATCCCCGACATACAACCCATCCGTTCTGGTAGCTGCCTTG
CGACGCATCCTACCGTCTTCCTTCCGATGGCAAAATGTGATCACCTACTTTGACCAGCGCACAGCTCGGGTGTCTCCATC
ACAGTTCCTCCGGCTTTACAATGCACTCGCTCCGATCGCGAGAGACGATTCCCGGGCGCTTGATATCCAGCATCTCTGGG
GAGGCAATTGGGAGAACCCTGATGCGCAACTTTCCTTCATTTGCGCATTCACGTCCCTATCGGCCGATCGGCTCGATGCC
ACCACGATTCCAGGTCTTCAACCGACCCTCTCTCTGGACGACTATGCACAGGCTCCGCCCGAAGTGAAAGAACGTGCCGC
CGAAGCAGTGAAGCACCCTCTTGTCTCTCTGGCCGCCATCTCTGCCATCTTTCACGTCGCCCTCCCCTCCCAGCATGCCT
CCACAAATGTTGAAGCCAGACGGTTGTTCCAAAAGGTTGTAATTCCTAATCTAGACATCTTTGTTGTCTCTGCCTTTGGT
GTACCGAAGCCGTGGCCAGCAACTGCTGTTGAAACGCTAAACTCTCTGTTCGAAAACTTCCTCTACAAACGCCAACCAAA
CTGGGATTTCGTCTTCGACAGTCTGTGGAGAAAGGACAAAGAATGGGTTATGGAGAGGCTTATCGAGGCACACGCAGCCG
AGCCTGGAGAGCTACCCCTCATATTTGAGTATGCCGTGAAGCACGGTTGGCTCAATGAACTAATCTACCTGCCAAACGGA
TTCGGGCTCGATCTGGTGGCCTATGCACACGGCCAGGGCTACGTCGACTTGGCGGAATGGGCTAAGAACAATGCTGATCG
CAGTACCGAGATCGCAAGACCGCTGATGCAGTTTCTTCTAATAAAGTCTGAGCTGGAATCTCAGCGCGGCGATGGCCAGC
CCACTCCGACCAAAACAAATGTCCCGCTAAAAGTGCGAACGGTATCGGCCCTGCTCAATATTCTTGAAGATTTTCTGCCA
AAGACTCCAATTCCCGAGCTTGTCATGCTCCAGCGCCAGTGCATCGCCATCTATCCTCGCCTGATCAACTATGGCGAAGG
TTTTGACGAAATTATCGAAGCTAGCGAGAAAGACAGCCACAATCTACCGCAGGAAGCGAACTCGAAAATGGAGGAACACT
TCAAGAAAATGTACAGCAACGAGATCGAAGTCCGAGAGGTCGTTGGTATAATGGACCACTATAAGCACTCACAGGATCCT
CTGGAGCAGGATGTGTTCGCCTGCATGATTAACAGTCTGTTCGAAGAGTACAGCCACTTTGGCGATTACCCGCTTGAGGC
TCTTGCCACGACCGCGGTTCTTTTTGGCGGCCTCATCTCGCATAAGCTTATCTCGGACTTACCTCTCAAGGTTGGCCTGG
GTATGATTCTCGAAGCAGTCAAGGAGCACAAGCAGGATCACCCCATGTTCAAGTTTGGCATGCAAGCCCTCATGCAGCTC
TACTCTCGGTTCAGAGAGTGGCCGGGGTTCTGTAGCCAACTTTTGCAGTGTGCAAGCTTGCGGGGGACCGAAGCCTGGAA
AAAAGCCGATGAGATCATCCGGGAGACGGACGAGGGCGCAGGGATTGCCGGAATTCAGGGGGCGCCTGCTTCTGGCGAGC
ATTTGACCAATGGAAGTGGCGACGAACCGTCTGTCGCAGAGCCACAGTATCTGCCATTCGCTTCTGTTGTGGTCGACCCG
CCTCCCCCAAATGCCGTTTTTGAGGATCCGAGTAACGACGTTCAGGGCAAGGTTCAGTTTGTGCTCAACAATATCACTGC
GAGCACTCTGCAGGCCATGTTTCTGGAGATTCGCCCGATGCTCGAATTCAAGCATCAGCAGTGGTTTGCCAGCCACCTTG
TTGAAGAGCGGGCAAAGATGCAGCCGAACTATCACAAAGTCTACTTGCAGCTCGTCAGCCACTTTGAAGACAAGTCGTTG
TGGGCAGAGATTCTCCGGGAGACCTACATCAGCGTTGCGCGCATGCTGAACTCAGAGTCAACTTTGCAGAATTCCTCGGA
CAGGGCACATCTGAAAAACTTGGGCGGCTGGCTAGGTCTTCTGACTCTTGCGCGCGACAAGCCTATCCGGCAGAGAAATA
TCGCTTTCAAGCAGTTGCTGATCGAAGCGCACGATACAAAGCGGTTGATTGTGGCGATTCCATTCGTTTGCAAAGTGCTC
AGTCAAGGCGAGCACTCCAACGTATTCAAGCCACCCAATCCTTGGCTGATGGAAATTGTCCACTTTTTAATCGATTTGTA
CCACAATGCCGAACTCAAGCTGAATCTGAAGTTTGAGATTGAAGTACTCTGCCAGACTCTCAACATCGACCACAAGAGCA
TCGAACCATCTGGCGAAATTCTGGCTCGGGTAGCTGAAGCCTCAGAACTTCCTCCAGACTCGATGGAGGCCTTTGACAAT
CTTTCGCTGAACGGTCTCGTACCTGGTGGCGTCGGCGCCGGCATGTCTTCACACGGCTTGGGCCCGAACGTGGTCTCGAA
TGCGATGCTGGAAATGATTCCCGATCTCATCACGAAAGTGAATGTGCCCTCCGTCAGCGACATGGTTATCGCGGCTTCAC
GTCTGGAGGAGATTGTCAAGGACGCCCTCATCCGGGCACTGCAGGACATTATCCAACCAGTTGTCGACCGTTCTGTTGCC
ATCGCTGCGATTGCCACGCAACAGATGATTCGCAAAGATTTCGCTACAGAGCCGGATGAGAACCGTGTCCGGACATCGGC
GATCAACATGGTCAAAGCGACAGCTGGCAGCCTTGCGTTGGTAACCTCGAAAGAGCCTCTCCGAGCCAACTTCACCAATT
ATATGCGCTCTCTCTCGAGCGACAATCCCCAGGGTCTTCCCGAGGGCACAATCATCATGTGTGTGAACTCGAATCTGGAC
CTGGCATCGGGCGTGATTGAGAAAGCGACAGAGGACCGTGCGGTCATTGAGATCCAGGAGATGATCGAACCCGAACTGGA
GATGCGGCGTCGTCACCGTATTCAGCGTCCCAACGATCCGTACGTGGACTCTTCTCTGAGCCGGTGGGCCATGACGATTC
CCAACCCTTTCAAGCTCAGCCCCAACCTGAACGGCTTGAACAGCGAGCAGATGGCTATCTACGACGACTTTGCTCGCCAT
CCGCGGCCAACGACAGCGGGTGTTGCTTCCGCTTCGCACGTGCAATCGGCTTCGGACGCCACTCGGTCGCTGGCAAATGA
GGTGCTCCAAGACCAATATGGGTCCCTGACGAACGTGCCCACTCCGGTCGAGACACCCTCAGCTGTGTCGTTGGGCTCGC
AGATGCAGCAATATCCGCATGTGCATAATGGCGTGGGAGGTGCCGGTGTTGCAGGAGCCATGGTGAACGGGCGACAATCG
GTACCAACGGTCGATGTGCGGCTTCTTACAGACCGCATCTCCAAGTTGGTAGTCGAGCTGCAGCGGGCCGCTACCGAGGC
CACGGAAGAACATTTCTCGGACCTGCCTCGACCGCACCCGGTTCTGGATGTGGTGGATGCTCTGGTGCAGACAATCATCA
AGGCACAGCAGTCAGCGGAGGATTTTGTGTTTTATGCTGCCGAGCAGGTGTGCCAGGCGCTGGTTTCCCAGCTCGAGGAC
AGCCTAGCTCTGGAAAGTCTCGTCCATGTGCTGGAAACGCTTCGCAAGATCGCCACCAGCCCGTCGCTGAGCAACCGCGT
CATCCAGTTCTTTCACTCGCAACCAGCACACGTCTTTCTGAACCTGCCGCTTGTCTCAGCCCTGCGTGGTACCGATCTGC
TGGACTGGCCAAACATCGACGCAGCCATGGCCGCAGCTCTGAAGCAGAGGAAGGAGGGGTCGATCATGTTCTTGATGCGG
CTTTTGGACCTTGCGCTCATCGGTGAGACTCCACTGGCTCTGTATGCCGACTTTGTGTACAGTCTGGCAGAAGCCTGGGC
TTGGGTCAACGATGAGTCCGACGTGCCCGGTGGCCAGGACTTCAAGGCCAAAGTTCTTGCGCCTGTTTCGCAGCCCCCAT
CGCCGGACCCGTCACAGGGAGCGATCAGCTCTTACCGCAAAGACCAGATCGAGTACGTCTTTGATGAATGGGTTCACCTC
TGCCAGAAGCCACATGTGCCCGACAGCATCCCCTTCATCTTCGTTGAGCAGATGAGGGCAAAGCGCATCGTGTCAGGCCG
CGAGGACCTGTTTTGCTTCCTGAGAGTCGCCGTCGACAAGTCTGTGGAGAGATTTGAGCTCGTCTCGCAGGCAGGCGGTA
CCATGTTAGAGGCATATGCTGCCATCGACTCGATCCCGAAGCTTATTGCCGTCTACTTGCAGGCCTCTGCCGATGCTGAG
GGTTCTTCAGGCTCGGCTCGCGCCGAATTGACCGACTCGATTCTGGCCCTGGCCGTCATGATGGTGAATCATCACTATGT
GAAGCACGGCGACGCCTTCAACCAGCGTGTCTTTTTCCGTCTCTTTTCCATGCTGCTCTTCACCATCGATCATATCTCGG
ATCGCCTCTCGGACGCGGATCTGAACGAGATTTTTCTGAGGTTTGCAACGCGCTTCAACGATCTTGGGCCGGCTACCTTT
CCCTTCTTCGTCTTTGCCTGGACGGAGCTCATCAAGCACAGAGAATTCATGCCGGCATTGCTACGGATACCGAACAACGC
TGGATGGGCCGCGTTCACAAAGATCCTCAAGCAGATGCTGGTCTTCATTGGCGAGCAACTCAAGACATCGGAAGTGCCCG
CGGCCATTAAGGATTTGCACCGCGCGGCGGTGAAGCTTCTCCTGATTCTGTACCACGACTTCCCCGAGTACCTTGCTGCC
AACCACGTTGTGCTTTGCCAGGGCCTCCAACCGTACCTAGGACAGCTTCTGAACATCATTCTCTTCTCCACGCCTAACAA
CATCACGAAGCTTCCCGATCCACAACAGCCGGGAGTGCGTCTTGACAGCTTAGAGGATGTGAACATTGCATCCCCGGTCA
TCTCTTACGACCCAGTACCAGTTCTTTCTCATATTGGACTGACGGCACTGCTTGACCAGGCATTGGAGACGGGGCCGACA
GAGGAGATTGTGGCTCACATCAAGCATGCCATCTGCAAGACGGATAGAAAACAGGCCATGTGGGGGAACACTCCGCTCAA
CACCAACATCTCCGTCGTGGACGCAGTGGTGCTCTACATTGGCAACCACGCGGTAGCACGGGCACAGGGCGGCGGTCCGG
TCTTCCAAGCGGACGCACCAGACATGGCCACGGTGTCGATGGTGCTCCATGAGCTCCCGGCGGAGAGCCGCTATTTCTTC
GTGTTCAGCATGGTGAACCAGCTGCGGTATCCCAATGCCCACACAAGCTTCTTTGGTCAGGCGCTTTTTGAGCTGTTCGG
ACACAACTTGACAGAGCCAGAGGAGACAGAGATTCGCGAGCAGATATGCCGGGTCCTCTTTGAACGAATTGTTAACTACT
GGCCGCAGCCTTGGGGGTTGCTGGTCGTCATCATCGAGCTTGTGAAGAACGAGAGATATTTCTTCTTTGACATACCGTCT
CTCAAGCTGGCGCCTGAGGTAAGGCGCAACATTCCTTCTTTTACCTGCTTACGGCCATTACTAACGGGCTCACAGGTATC
AGAGCGCTTTGCGTCGCTTGTCACTCGCTCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62