GenePrediction:GLEAN_7353 Details

Name: GLEAN_7353
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2590204..2588398 (- strand)
Length: 1807
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2590204..2590080 (- strand)
Length: 125
Type: CDS
Source: GLEAN
Position: GCSC_140:2590024..2588398 (- strand)
Length: 1627
>GLEAN_7353 class=GenePrediction position=GCSC_140:2590204..2588398 (- strand)
ATGGCGTCAGTGCCGTCAGAGAAAGATTTGCAGGAGCTGCTGCGGCTGCTCACGACGACGCGCAAGCTGCCGATCCTGCA
GGCCATGAGCCAAGTCCGGGCTCTGCAGGCGGCGAGTCTGCGAAGGTGAGAGGAGTGAATCCAGGCAAGCAATTTTTTCG
CGCTGACACTCGGCAACAAGCATCCGGCAGATTGCCGAAGCCCCGGCGGAGGCTGTGCAAGTAGCCATCAAGGATGTCGC
GGGTGCTAAGGCGCTGCAGACGAGCTGCAAAGCGGCGGTGAAGAAGATGGACAAGGCGGGAATGGCTGGCACCAAACGGC
CGGCCGGAAGCCAAGAAAGCCAAGAGGGCAATAGCAGCAGCGCCGAGAGCAAGCGGGCCCGGCCATCGCCTGCGCAACCG
GCGGCTGGTGGGCTCTATCTACCGGTGGCCATGACGCCGGCCGACCTGGAGAAGTCGCTGGATCTGGCCGTAGAAGAAGA
CGACGACCGGATGGCTGCTACGGTCCTGCTGACCAACCGTGCTCCCCTCCTGCTTGCCTTTGCCGTCGAGCTGCTGCGCT
ACACCATGCCGGAACAGCCGCCGTCGAGCCGACTGAGCCTGGCCCAGGCTGTCGTCAGCGCCAATGCGCGGTCCAAAGCT
GTCAGTTTGGGGATCGCCCGGGAGCGAGGGCGTGGTTCGGGGTCTGGTGAGGGCAGCGGCCGTGGCAACAGCAACGATGA
CGACTGGGGCGCTGGCCAGCCACGCGTTCGCATCATGGGACGCGAGGTGGCTGTGCTGAAGCGAGGGGGGTACACGTGGC
GAGGAGAGGAGGATGTGGAGGGAGTAGACGAGGTTCAGAGGGACAACAAGGACGAGAAGAAAAACGAACCCGAAACTGGA
GAGACACCCTCATTAAAGACAGTACCAGCAACAGAATCACAGCTACCACCACCCACAGGCTCTCGACCTGCTCCTGGCGT
CTGGTCCGTCAGCTCGACCATCTCGCTGCGCGGCTCCGTCTTTGTGGCCCACGCCACCACCATGACCGACGCGACTCAAC
GGACCGGCCTCATCCGCGGACTGATAGCAGCCCACCCACGGCTGCTCACGGCCACACACAACGCCTGGGCATCGCGCGTT
CGTGCAGGCGGCCCTGACAGCGACTATGCCGACCGGATGCGCCAGGACGCCTACGACGACGGCGAGTCAGGCTGTGGCGA
CTTCATGCTGCGCGTGCTGGCCGAGCTGGCCGCCGTCGACATCCTCGTCGTGCTGACCCGCTGGTACGGTGGAACGATGC
TGGGGCCTGACCGCTGGCGTCTGATGCGCAACTGCGTCACTGGTGCCCTGGCCGACCGACTGCGTCGCACCGGAGCCGAG
GTGACCCTGGGCGGCGAGGCGCTGTGGGCCTTGGACCTGGAGGGACGGACCAGCAGCTCGACGGCCGTGACGCCTGGCTC
CAGTCTCACGGCTGTGGTCGGCATGGCCACGCATCGCCCCGAGGCCGCACGCCAGTACCTGCTCAAGAGCTTTGCCTCGG
CTGAGGAGGGAGCAGCACCGGGAGCGGTGTCTAAGAAGCGAAAGACGGTCAAGGCTCTGGACGCGGAAAAAGAGGACAAC
CTTGCGCTGCTGCTCGGCGCCCTGCGTCTGCTCTACGACAGCTGGGCCGACCATCTGACACCGGCCGAGCTGGACCGCCG
CGCCTGGAGCTGGTATGTGGCCGTGCGGCCGGACGTCGACGTCGGCCCTGCTGGCTGGGGGGCCAAGGCCCGGCTGCGGC
TCAGCGCCATCCTGGCCCTGCGACGACCAGCTCCATCCAAGGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62