GenePrediction:GLEAN_7354 Details

Name: GLEAN_7354
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2587651..2585520 (- strand)
Length: 2132
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2587651..2585730 (- strand)
Length: 1922
Type: CDS
Source: GLEAN
Position: GCSC_140:2585619..2585520 (- strand)
Length: 100
>GLEAN_7354 class=GenePrediction position=GCSC_140:2587651..2585520 (- strand)
ATGTTTGCAGCAGCAACAACATCGTCGTCTGGCAGCCAGGCGGTGGTGGTGCGTGTCTGCTGGAGGAGAGCAGCAGCAGC
AGCAGCCACCGGCACGGCACCATTTTCCATTTCGGCCGTGACACGCTCGGCCTCGACATCAGCAGCAAGGCGGCCCAGTT
TTGTCCACCCACGACGGCGACAAGCCCAGCCGCTTCAGACGCACAGCCATATCCGCCCCAACCGGCTGCGGTTCTTCTCC
TCGAGCCAGCGTCGGCGCAACGACAATGCCGCTACCGATTCGTTCGACCCCCAGAGCATCGAGCGCGAGAGCGACCAGGT
GGACGTGTGCATCATTGGCGGTGGGCCGGCCGGACTGAGCGCGGCCATCCGGCTGAAGCAGCTGGCCAACGAGGCTGGCA
ACGAGGACTTCCGTGTGCTGCTGCTGGAGAAGGCGGGCGAGATTGGCGCACATATCCTGTCGGGCGCGGTGATACAGCCA
GACGCGGTGCAGGAACTGATCCCCAACTGGCTGGACGAGGACAACCCGGACCGATTTGAATTTGCCACGCCGGCTGGCAA
GGACAAGATGCGCTTCCTGACCAAGACCATGTCCTTCCCGGTGCCGGCGCCGCCGCAGATGCACAACCACGGCAACTACA
TTGTGAGCCTGAACCAGTTCGTCAGCTGGCTGGGCGCGCGAGCTGAGGAGGTCGGCGTCGAGGTATACCCGGGTTTTGCG
GCGTCTGAGGTGCTATACGCGGCAGACGGATCAGTGCGCGGCGTGGCTACCAACGACGTCGGCATCGGTCGCGACGGCCG
GCCCAAGGACTCGTTTGAGCGCGGTATGGAGTTCCATGCCCGCGTCACCCTCTTCGCCGAGGGCTGCCACGGCAGCCTGA
CGAAGCAGGTCATCAAGCGCTTCGACCTGCGCCGCGACAGCGACCTGCAGACTTACGGCCTCGGCATCAAGGAGGTCTGG
GACGTGCGACCGGAGGTGTTTCGCCGCGGCGAGATCGTCCACTCGCTCGGCTACCCGCTACCCTACGACACATACGGCGG
CTCGTTCATGTACCACTTTGGCGAGAACCTAGTCAGTATCGGGCTCGTGACTGCGCTCGACTACCCGAACCCATGGATGT
CGCCGTACAACGAGTTCCAGAAGCTAAAGCAGCACCCGATGTTCCGCGCCGTGCTGGAGGGCGGCAAGTGCATCTCGTAC
GGCGCGCGCGCCTTGGTCGAAGGCGGCTTCCAGTCGATTCCCAAGGTAGCCTTTCCGGGCGGCGCCATCGTCGGCGACTC
GGCCGGCTTCGTCAACGTGCCCAAGGTCAAGGGCACACACAACGCGATGCGATCGGGCATGTTGGCGGCCGAGGCAGCCT
GGAAAGCGATGGGGCACGCGGCCACGACGGACGAGGAGGACGCTCCGGTCGAGGAAGAAGAATACGGCACCAGCCGGGAC
CACGGCAACACAGTGTTTCTGTACGACTACGAGGACGCGCTGCGGCGGTCGAGCATCTGGAAGGAGCTGCACGAGGTGCG
CAACATGCGGCCGTCGTTCCAGACGCCGCTCGGGCTGTACGGCGGGCTCGTCTACTCCGGTCTCGAGGGCTTTGTGCTGC
GCGGCCGCGTGCCGTGGACTCTGCGCCACCGACACGCCGACCACGCGGCCACGCGGCCAGCAGACCAGTGCCGCCGCATC
GAGTACGCCAAGCCGGACGGCAAGATCAGCTTCGACATTCTGACGAGCGTGTCGCGCACCGGCACGAACCACGAGGAGGA
CGAGCCGGTGCACCTGCAGGTCAAGGACTGGAAAAAGCACACGGCCGAGACGTTTCCGGCTTTCCAGGGGGTCGAGAACC
GGTTCTGTCCGGCGGGCGTGTACGAGTATGTGGACGACGCGAGCCAGCCGGAGGGCGTCCGGTTCCAGATCAATGCACAG
AAGTAGGTTTTTTCTTTCTTTCTTTTTCTTTTTGTTTCTTTTTGTTTCTTTTATTTCTTTTCTCTCTCTTTTCTCTGCTT
CTTCTTTCCGTCCTTTCTCGCTAACAACCCAGCTGCATCCACTGCAAGACGTGCGATATCAAGGCGCCCAACCAAGACAT
CAACTGGCAGGTGCCCCAGGGCGGCGAAGGCCCAAAGTACTATATGACGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62