GenePrediction:GLEAN_7355 Details

Name: GLEAN_7355
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2582603..2581579 (- strand)
Length: 1025
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2582603..2582326 (- strand)
Length: 278
Type: CDS
Source: GLEAN
Position: GCSC_140:2582254..2582167 (- strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_140:2582102..2581688 (- strand)
Length: 415
Type: CDS
Source: GLEAN
Position: GCSC_140:2581595..2581579 (- strand)
Length: 17
>GLEAN_7355 class=GenePrediction position=GCSC_140:2582603..2581579 (- strand)
ATGGAGGTCATCCAAACACACCCCACCAACGCCCTGCAGGCAAAAGCCTTCACCGCACCTGGGTCGCTATCGTTCCCTAC
TGGCCACAGCGAGCTGACGCCTCCGCTCGAAATCTCGGGCACCAGCAGCAGCCAGCAGCAGTCGTTCGGCTCAGCCAGTG
ATCTGTCACAAATTGGCGCCGATGCTGCCGGCGCTTCGGGTGCTGAGGTGGCTCCAGCAACTCCGGTTGCGACGCCTGTT
GCGATGCACAGTGGGAGCGGTTTGACACCGACTTTACAGTATGTTCTCATGTCACGACCCCTGGCTCTTGCTGTGGGTTC
CAGCGCGGCTTACCTTTTGCTCGTCGAAGAAACATTGTCGCTACGGTCAACCTTGCCTGCCGTCTTGACTTGAAGACCAT
TGCTTTGCACGCCCGCAACGCCGAGTACAACCCAAAGGTGAGAAGCATCAGAGTGCGGCAACGTTGTTGCACATGCTCGG
TCTGCTAAACGTCATCTACAGCGTTTTGCGGCAGTTATCATGCGCATCCGCGAACCCAAGACGACAGCCCTGATCTTCGC
CAGCGGAAAGATGGTGGTGACTGGCGCCAAGTCGGAGGACGACAGCAAGCTGGCTTCACGCAAATATGCCCGGATCATCC
AGAAGCTGGGCTTCAATGCGAAGTTTACCGACTTTAAGATCCAGAACATTGTCGGTTCATGTGACATCAAATTTCCCGTC
CGTCTCGAAGGCCTGGCCTCACGCCATCACAATTTCAGCTCCTACGAGCCCGAGCTCTTCCCCGGTCTGATCTACCGGAT
GATTAAGCCCAAGATTGTGCTGCTCATCTTTGTGAGCGGGAAGACAGTGCTCACCGGCGCAAAAGTCCGCGAGGAGATCT
ACCAGGCCTTTGAGATGATCTATCCTGTGCTGCAAGGTACGTGATGCCCCGGAAGGCCGCAGCCCTATGGCGTATCGGTC
GTGGTGCATACGACGAGAATGAATACGAGCTAACGCGTTACGCTTCAGATTTCCGCAAGGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62