GenePrediction:GLEAN_735 Details

Name: GLEAN_735
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1752419..1753496 (+ strand)
Length: 1078
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1752419..1752422 (+ strand)
Length: 4
Type: CDS
Source: GLEAN
Position: GCSC_97:1752505..1752611 (+ strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_97:1752771..1753496 (+ strand)
Length: 726
>GLEAN_735 class=GenePrediction position=GCSC_97:1752419..1753496 (+ strand)
ATGGGTATGTCGATTCTCGTGCTGGCCATCTGGCTGGGGCGTTCTTGTTTGCAGTCTTTGCCGTGCCGTTGCTGACTTGT
CGCCAGCTTCCTACGGAGGATACGCAAAGACGTCATATGGCGGCGAGGCGGTGGCCGAGGGTGGTGGTGGTTTCATGGGT
GGTGGCTCACAGTCGGCGAGTCAAGGTGGAAGGGTGAGTTGAGTCTACGTCTCGTCTCTTTCTGTCTCTTTCGTTTTTTT
CCCGTTTTCTTTCTCTCTTTTTCTTCTTTCCCTCTTTCTCGCTTTCTATTTCCTCTTTTCCCCTCTCCCTCTTTCTTTTC
TCCCCCTCTCTCCTCTTCTCTGACCCCCTCAGAACTACAACGAGGACTCCCTCCGGCCCGTTACCATCAAGCAGCTGCTC
GACACCGAGGAGGCCTACCCCGGCGCCTCCGAGTTCACCATTGATGGCGCTGCCGCCACCCAGCTCACCCTCGTCGGCCA
GGTCCGTGCCGTCAACCCCCAGCCGACCAACGTGACGTACCGCATCGACGACGGCACCGGCTGCATCGAGGTCAAGAAGT
GGGTCGACGCCGACAAGAACGAGGAGGCCGAAGCCCGCTTTGCCCTCGACCAGCACGTCCGCGTCTTCGGCCGCCTCAAG
CTCTTCAACCAGAAACGCTACGTCGGCGCCCACTTTCTGCGCGCCATCGACGACTACAACGAGGTCAGCTACCACATGCT
CGAGTGCACGTACGTCCACCTGTGCCTCACCCGGGGCGCACCCGAGGCTGGTGCTGGTGCTGGCGCTGGCGCTGGTGCTG
CTAACTCGGCCGGCACCCACAACGACAGCATGTTTGTCGACCAGGATGGCGGCGGCTACGGCGGCGGTAGCGCTGCCACC
AGACACCTCTCGCCCAACGGCCAAAAGATCTACCACTTTTTGCGCAACATGGCCACTGGCAACGAGGGCATCAACGTCAA
CGTCATCATCAACGAACTCAAGCTCGGCTACGGTCCCACCATGACGGCCATCCAGGAACTGACCGATAACGCGGTCATCT
TCGCCACCGTCGACGACGAGACCTTTGCCCTGATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62