GenePrediction:GLEAN_736 Details

Name: GLEAN_736
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1768435..1769131 (+ strand)
Length: 697
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1768435..1768637 (+ strand)
Length: 203
Type: CDS
Source: GLEAN
Position: GCSC_97:1768726..1769131 (+ strand)
Length: 406
>GLEAN_736 class=GenePrediction position=GCSC_97:1768435..1769131 (+ strand)
ATGCAAGAGAAGCGTCCTCAGCTGCAGCAGCACGATGGTGCCGGCCTGCGCATCGGCATCGTGCACGCGCGCTGGAACGC
CGGGATCATCGACCCGCTGTTGGAGGGCACTCGCGCCAAGCTGCTAGCGAGTGGCGTGGCCGCTGCCGACATTGTGGTCG
AGACTGTGCCAGGCGCATGGGAGCTGCCGGTGGCCGTCCAGAGGTAAAAAGGGAAAGACCAATAAAGAATGCCACTTTTG
GACGCTGGCTCGCTAGGGAAACCGCCGTGCTGATTCTGATCCTCTCTCCAGACTCTACTCTGCGTCCCAGATCCAGGCAG
CCTCCTCGGCTGGCCCGGACCTCTCGGCTGGCGATCTGCTGGGCGGCAGCACATCCGACCTGGCGGCCGCGTCCAAGCCG
TCGCCGGACGCACCCTCGACCAAGCCGTTTGACGCGCTCATCGCCATCGGCGTGCTCATCAAGGGCGAGACGATGCACTT
TGAATACATTGCTGACAGCGTGTCGCAGGGTCTGATGCGCGTGCAGCTGGACATTGGCGTGCCCGTCATCTTCGGCCTGC
TGACCGTGCTGAACGAGCAGCAGGGACTGGCCCGCGCCGGCGTCGTCGACGGCAGCCACAACCACGGCGAGGACTGGGGC
TCGGCTGCCGTCGAGATGGCCGTCAAGCGCCGGGCATGGCAGGCAGGACAGCTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62