GenePrediction:GLEAN_737 Details

Name: GLEAN_737
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1777471..1779652 (+ strand)
Length: 2182
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1777471..1777892 (+ strand)
Length: 422
Type: CDS
Source: GLEAN
Position: GCSC_97:1777941..1778834 (+ strand)
Length: 894
Type: CDS
Source: GLEAN
Position: GCSC_97:1778888..1778986 (+ strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_97:1779042..1779100 (+ strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_97:1779152..1779298 (+ strand)
Length: 147
Type: CDS
Source: GLEAN
Position: GCSC_97:1779347..1779488 (+ strand)
Length: 142
Type: CDS
Source: GLEAN
Position: GCSC_97:1779544..1779652 (+ strand)
Length: 109
>GLEAN_737 class=GenePrediction position=GCSC_97:1777471..1779652 (+ strand)
ATGTCTTCGCCCAAGGCTCTCAGCCGGCAGAACTCGCATCTATTGATGCAGGACGACCCCTACACGCTGGGGCCCAGAGG
CAGCACGCTGGCAACCCTTCTGCGCCGCCGCCCGTCGACCACCAGCGTGTCCCTTGTCCGGGATGAGGAGGAGGCCGTCG
TCGGGGCCGGCCTGCCGGGCTCCGGGGCCGTGACGCCTTCTGCGAGTGCCAGCTTCCCCGTCGGCCTGTCCGGCTCGCCC
GAATACCGTCGTGAGCTGTACCACGACGACGAGGATGTGCGGCGTCACGACGAGCGCCGCCTCAGCGCCCTGCTCAACAA
CCCACAGATGCGCAGCATGCGGCTGATCGGCAAGGCCAAGCGGTATCGCTGGGAGCGGTACTGGAAGACGGAGGACCAGC
TAAAGGTCCTGTCGGCACCATTGTAAGCCATGTCTCGCTGTCCTGTCCTGTCCTTGGCCTGACTCGGCAGACGTGCATAC
TATGAGCGCAACAACATGCTCATCCAGCAGTATCTCTACATCGACCGCCTGCTCAACTCGTCGCTGCCCCACGATCTTCT
CAACGAGTACAATAGCCTGCACAGCAGCCGTTCCTACCGTGGCCTCGAGGTGCCGGCCACCATCTCCGAGGAGTCCATGT
CGGCGTCGCCAACCGGCAGCGGTCAGCTCTCGACGCCGCCTCTGGGTGGTGCCACGGCAGCAGGGGCAGCCACAGCGGCA
GCTGCTGCCCGACGGGTCAAACGAACGCCCAAGGCCATCTACCGGCCGGCCGAGACGACGCCGCTGCTGGAGGCGCATGG
CACGGACGACGAGGATGAGGACGACAGCCACGATCCGGACGAAGAGCGGCTGCCGACTCCGGGTGGCAGCGGGCTGCAAG
GAAACGGATATGGCGCAGCGACGATGACAACAACAGCTGCAGCAGCAACAATAGCAGACGCAGATGCCGACACGACCTCG
CCGACGGGCAGCCAGTCGCCCCGGGTCGAGGACATCCCGCTGCTGCTGGAGGAGGACGAGGACGTGGATAGCACGGCGCC
GGTGGTGACGCTGGCCATTTACGTCAACCTGGCGGCGAACGCGATCCTGCTGGCCGGCAAGCTGGCCGTGGTGCTGTCGG
TGCCGTCGATCTCGGTGCTGGCGAGCCTGGTGGACGCGGTGCTGGACTTTCTGTCGACGGCAATCGTCTGGACGACCACC
TGGCTGATCAGCAATCAGGACCAGTACCGCTATCCTGTTGGGCGGCGCCGATTGGAACCCCTGGGCGTGCTGGTGTTCTC
TGTCATCATGATCACCTCGTTTGTGCAGGTCATGCTGCAGGCGGTTCAGCATCTGGCGTCCGATGACCGGAGCATCATTG
AGCTGTGGGCTTCACTCTTCTTTGTTCCCTTTTCTCGTTCTCCGCTAACGCCCCCAGTGGAATCCCCGCTCTGGCCATCA
TGTTTAACACCATCGTCATCAAGGGCCTTTGCTGGCTGTGGTGTCGACTGGTCAAGAACTCCAGCGTGCAAGCATTGTAA
GTCCTGTCGCTTCGGCTGTCTTGCCACCTACACGACGCTGACCTCTTCTAGGGCTGCTGATGCTATGACCGACGTCATCT
TTAATGCCGGCTCCATTGCCTTTCCTATCGGTATGTCGTCGTTTTCCACCATGGTCCCGTTCGCCAAGCTGACAAGGACA
GTTGGTTTTTATGCCCGCATCTGGTGGCTGGACGCCCTCGGCGGACTGCTGCTCTCCTTGGTCGTCATCCTGAATTGGTC
GCGCACGTCTATCGAGCACATCAAGCACCTGTCGGGCTTTTCGGCCACGGCCGACCAGCGTAACATTTGTAAGTTTCCGC
TCCCTCTTTCTGTGCCGCTCTCTCTCTGACCAGCAGTGCTCTACCTGACCATGCGCTTCGCCAAGACCATCCGGGCCATC
CAGGGCCTGCAGGCGTACCACGGTGGCGACAAGCTGATTGTCGAGGTCGACATTGTGCTGGACGCCAACATGTCGCTCAA
GGACAGCCATGATTTGAGGTCAGTCCTGCCAGCATTTTGGTGTCGTGCCCTGTCTGACCTTTTTCCCTCCCAGCGAGAGT
CTTCAATATGTCATCGAGTCCGTACCTATTGTCGACCGCGCTTTTGTGCATGCCGACTACGCTGATTACAACCTGCCGAC
ACACATGGAGCAGCAGGCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62