GenePrediction:GLEAN_738 Details

Name: GLEAN_738
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1781740..1782098 (+ strand)
Length: 359
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1781740..1781854 (+ strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_97:1781909..1782022 (+ strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_97:1782073..1782098 (+ strand)
Length: 26
>GLEAN_738 class=GenePrediction position=GCSC_97:1781740..1782098 (+ strand)
ATGGAGAACGGCACGGCTGGCAGCCAGGCCGAGGGCACAGACCCCAGCGCCTTCCTCAGCGAGATCATTGGCAGCCCGGT
GGTTGTCAAGCTGAACTCGGGTGTCGTGTACAAGGGTTAGCGAGGCGTTCCCCCCCTAGTATGCCCAACCGATGCTGACA
ACGTTGCAGGCGAGCTGCAATCGGTCGACGGCTACATGAACATTGCGTTGGAAAAGACGGCAGAGTATGTCAACGGCGTC
AAGCGGAGGACGTACGGTGACGCCTTTGTGCGCGGCAACAACGGTGAGTCGAGAGTCCGTGATCTGGTTTCGTGCGCATG
CTGACAATCACAGTCATGTATATTTCGGCAGACGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62