GenePrediction:GLEAN_7395 Details

Name: GLEAN_7395
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2353844..2349582 (- strand)
Length: 4263
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2353844..2353824 (- strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_140:2353722..2353609 (- strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_140:2353551..2353376 (- strand)
Length: 176
Type: CDS
Source: GLEAN
Position: GCSC_140:2353293..2352004 (- strand)
Length: 1290
Type: CDS
Source: GLEAN
Position: GCSC_140:2351905..2351655 (- strand)
Length: 251
Type: CDS
Source: GLEAN
Position: GCSC_140:2351587..2351343 (- strand)
Length: 245
Type: CDS
Source: GLEAN
Position: GCSC_140:2351283..2350860 (- strand)
Length: 424
Type: CDS
Source: GLEAN
Position: GCSC_140:2350796..2350583 (- strand)
Length: 214
Type: CDS
Source: GLEAN
Position: GCSC_140:2350518..2349582 (- strand)
Length: 937
>GLEAN_7395 class=GenePrediction position=GCSC_140:2353844..2349582 (- strand)
ATGGATCCGGAGTCGACGGAGGTGTGTCCACCCCCCAGCCTCACTATTGCGGTGGTCAGGCGCATGATTGCGGCGGTAGA
GCCCTTGTGGAACCACTCACTGACATGCATTGCTACTGATAGGTCTCCTGCGTCCTCCTTACCTCGTCCAATGGCGGTCA
AGAAGACTCGGCCGCGCAGGTTTCTGCGCTGGCCTTTGACACAACCCAGGAGCTTCTATGGACAGGGAACAACGAGGTAT
GTCGGCGCAATCTCCTTTGCCGAAGGGTGTCCTGACCGATCGGTTCTCTGCAGGGCCGTGTTGCCTCATTCTATGGCGCC
GACATGCAGCCATATGTCTCGTACATGATGCAGCCTGCGACCGACGGCGAGGTCCGGCAGATTCTCGTCAACGAGGCCGG
CGTGGTGTCTCTCGGGCCCAAGGGTCTTCATATGGCCTTACGGCGCGGCCTCCCGCTGTGGAATTGCAGGTGCGTAATGC
TGCCGGCCTGTTGCTCTCTCCGCCCTCATCTTCTCCTTCCTGACATACTTGCTCCCTATCCCCCATTTCAGACACGACGA
CATGGCAGACCTTTGCTGCATGAGCTTCATGTCCACTGCGGCCACCGAGGTCCTCGTGGCTGGCCGCCAAAACACCATGT
TCGTGGTCGACCTCAAGGAGGGCGAGATCACCCGCCAGCTGGACACGGAGAACCACTACACCATGATGAAGCGCAACAGC
CGATTTATCTGCGGCGCCACGACGCGCGGCACCGTCGACATTATCGATCCTTCCACGTTTGCCGTCCTCAAGAGTTGGAC
CGCCCACTCCGCCTTTATTCACGACATGGACGTCCAGGCCGACTTCCTGGTTACCTGCGGCGCCACCCTTAAGCAGCAGG
GAGCCGTCATGTTCGACCCGTATGTCAACCTCTTTGATCTTAAGCAGATGACGTCCATGGCCCCCATCCCCTTTCCGCCC
TGTGCTGCCTTTGTGCGCATGCATCCGCGCATGGTCACGACGGCCATCGTGGCCTCGACCTCGGGCCAGATCCACATTAT
CGACCTGATGAGCCCCAATACCAGCAGCGTCAAGCAGGCCAACATTGTCTCTTTCCTGACCCGCATCGACATCTCACCCA
CCGGCGAGGCACTGGTCCTGGCTGACAGTGACTGCTACATGCACCTCTGGGGCTCGCCGTCCGGCATCCAGTTCACCGAG
TTCCCCGCCATGATCGAGACCGAGACGCCCGAGGAGCCACATAAGGAGACCGAGTGGGAGGACTGGTCGGACGATGAGAA
CGACGACACCTATATGTCTGGACGCAACGGCAACAGCAACGGCAACGGCAGCGGCAATGGCAGCAACAACAACAACGGCA
GTGGAGCAAGCGGCAGCACCGAGGACCGAAAGAGGGACGGCGCCGACCCGAGCTCCCGGCTGCCGCTCAACACGGTCGGC
ATGCCCTTTTATCGCGAGACCCTACTGTCGGCCTTTCCCAGCCTCATCTCGGACGTCGGCGCGCCGCCGCCGCGCTACGA
CAGCAGCTACCTCGAGAGCTTGACCCCGTTTGAGTACGGCTGGTATGCCCCGAACACAGGCGTCACGCTGCCTAATCAGG
TCGAGGACACGCGCAAGGACGAGAAGCCGGCGCAGACCATCCAGGCGCCCAAGTTCCTGAGCGACCGCTCGCGCGAGTCC
AAGTCGTCTGGCGTCTCGTTGGGCCACCCCAACGGCGGTGATGCCATCCCGGATGTACTGGAGTCCTCGGAGCTTGCTAG
TCTCGGTCCCGAGGCCCCGAGCATGTACAGGACGGTAGAGATTAAGTTTAGCAAGTTTGGTGTGGACGATTTCGACTTTG
GGTGAGTGTTGTTTTGCTGCTTTCTTTTCACTTTCTTTTTTTCTCTCTTTTTTCCGTCTTTCTTTCCTTCTCTGCCTCTT
CCCGCCATTAACAGGACAGATACTACAACCGCTCGCAATATGCCGGCCTAGAGAACCATATTGCCAACTCCTACGCCAAC
GCGCTTCTGCAGCTGCTGCACTTCACCCCTCTGATCCGCAATCTAGCTCTGCAACACGCCGCGAGCTCCTGCCTCGACGA
CCAGTGTCTCCTGTGTGAGCTGGGATACCTGTCTGACATGCTGCAAAAATCCGAGGTTGCCACCTGTCAGGCAGCCAATA
TGCTCAAGACTCTGAGCAGCCTTCCTCAAGGTGGGTTAGCGGGAGACCATTGCTGTGATATGCTGTGCTTCTCTGTTGAC
CCAACTGTCTCTTGCAGCTCATCAACTCCGCCTCATTGAGGAGGAAAACCCCAACACGCCCATCACCGAAATGCTGCAGA
ATCTGACACGCTTTCTGCTGACGCAGATCGCCAGTGATTTTAGACGCGTTTCGCCTGGTTCAAATGCCATGGAAGAAGCC
CTGGCAACGGCAGGCGTGACATACATGAGATGCATGCAGTGTCGCAGCGAAACAAGCCGGGCTGTATCAACTTACGTCAA
CAATCTGAAATATCCAGCGCCTGTAGGTAGACTTCTCTGCTTGTGTATGTGTCTTTCACGGTCAGCTAACCGTTCCCGCA
GCAGAGACAGTCCAGCAGGGGAGGAAAGCAGCCAAAAATCACGTTTTCCCAAGTTTTGAAGTCGAGCGTTGAGCAGGATT
CATCCACTAAGGGCTGGTGTGAAATGTGCCAGCGCTATCAGACACTCTTGAACAGGAAGACGATCAGCCGCATTCCTTCG
ATCCTGACCCTCAATGCCAGCGGCCCGCAGAATATGAACTATCCGGAATTCCGTCGCCTGTGGGGGACTCCCGGCTGGCT
GCCAGAAGAGATCGGCATAATAGTAGACGCTGCCGGTCAATTTTTTTGCTACGAAGGAGAAGACCTCAAGCTGCACTTGC
AGCGAGGCATCCACGACATCAAGGTGTACTCTCTCATGGGCATGGCCGTCAATGTGGACAACGGAGGACAACTGCAAAAA
CCTCATCTTGTAGCGATGGTGAACGGTACGTATCTTGGACCAGAGCAGTGCCACGTCTGGTGCCGGCAGCTTATTGACAC
CTCTGCAGTGGCACATTCGGAGCCGACGCCTCTTGCCAAGTCCCAGTGGCACCTGTTCAACGACTTTTTAGTCCGCCCGA
CGTCAACCGGAGAAGCTCTGTCGTTCAACACGAACTGGAAGACACCGTCTGTCGTCCTCTTCCAGCTGAAGAGCGAGAAC
AACAAGATCGACACGACATGGCAGAGCAGGATTGATACATCCATCCTCTTTATGGATTACGGGTAAGCTTGCGTTTCATG
CGCACATGGACTGAGAGTCCGGGCTGACAGTGATCTTCTTATGTAGGCGACCAACAGGCAACGAGACATACCAGCCGCTG
AACCCGAGCACAGAACGGCCGGGTCCGGACACCATAATGGCTTTGGACACGGAGTTTGTGGCTCTCAAGCGACCAGAGAT
CGAGATGAACTCGGAGGGAGAGATGGAGACGATTCGGCCGATGACCCATGCCCTTGCACGTGTCTCCGTGGTCCGTAGCC
AGGGTCAGGACGAGGGGCTTCCCTTTATCGACGACTACATCATCATCAAGGAACCCGTAGTCGACTACCTGACACTCTAC
TCGGGCATCACACGCAATGACCTCGATCCGCGCACGTCCCGCCACACGCTCGTGCCGCTCAAGAAGGCGTACAAGAAGCT
CTGGGTTCTGCTGAATCTGGGCTGCAAGTTCCTTGGGCACGGCCTGAAGCAGGACTTTCGTGTTATTAACATCCAGGTCC
CCAAGTCGCAGATCATCGACACGATCGACCTGTTCTTCCTAAAGTCCAGGCTGCGCAAGCTGTCCCTCGCCTTTCTGGCC
TGGTGGGCACTGAAAGAGAACATTCAGCAGGAGACGCACGACTCTATCGAAGACGCGCGGACGGCGCTGAAGCTCTACCG
GAAATACCTCGAGTACAGGGATGCTGGCGTGTTGGATGCACTGCTGCAGGAGGTCTACCGCGTGGGGCGTGACGTGAATT
TCAAGCCGCCCAGGCGAGACGACGGCGAGACGCACACAGGGCCTGGCTCGCCCGGAAGCGGTCTGGCTGCCGCAGCCACG
GTGGTTGCTCGAAGCAGCGGATCCTTTGTGAGCGGGCTCGGCTCTCCCAACGGAAAAGGCCTAGCCGATCAGAGAGGCTT
TCAGATCAATGGATCTCCAGTCCGGACAGGACTGTCTAACGGCGGTCTCGGCTTTGCTCAAACGACCCAAGCAATACCCT
TTCGTCCGAGCAGACACGGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62