GenePrediction:GLEAN_7397 Details

Name: GLEAN_7397
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2340884..2339681 (- strand)
Length: 1204
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2340884..2340831 (- strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_140:2340778..2339830 (- strand)
Length: 949
Type: CDS
Source: GLEAN
Position: GCSC_140:2339766..2339681 (- strand)
Length: 86
>GLEAN_7397 class=GenePrediction position=GCSC_140:2340884..2339681 (- strand)
ATGAGTGCGCAACTGGCCCAGCTGGAGGAGGACCGGAGCCAATATCAGGAGCAGGTGAGCATGCAGCTGCAGCACTGTCC
TCATCCACCCGTACTGACGTGAACAGCTCGACCTGGTGCTCAGCTCCCTGCGCGACGACCCCGACAATGCGGAGCTACAC
ATGCTCAAGGAGGAGCTGCAGTCGGCGCTGCAGATAATCATCGACTCCATGGCCGATATGAAGCCGAAGAGCGGCACCCG
GCCGTCGGGATCGACCGCGACAGGCCAGCAGGAGCAGCAGCAGATGGTAGCCGACCAGGAAGACGGCGAGACGGCAGCGC
CGACATCATCGACGTCGTCCTCGGCGCCGCCAGCCGTCACGTTCAAGGTGAACGAGACGGTGCTGGCGCGCTGGGTGACG
GGCGACAAATCGTTCTACACGGCGCGCATCATGTCAGTGACGGGGTCCAAGGCGGCGCCCATGTACACGGTCAAGTTCAA
GTCGTACGACACGATCGAGACGCTGCGGGCACGCGACATCCGGCCGGTCGGAACAGGCGGAAGCGGAGGCGGAGGTGGTG
GCAGCAACAGCAACAGCAACAGCAACGGTGGAAAGCGCAAGCAGGACAGCGTCGAGTCCGGATCGGCAGCACCCTCGAGC
CTCTCGTTGCCACCGCCACCACCACCACCAATGGCCTCTTCAAATCCGCTTTCGACTTCGTTGCCACCACCGCCTCCTCC
ACCGACAGCAGCAGCAGCAGCAGCAACAACAACAGGGACAGGCACACCGCCACCGCCACCGTTTGGCCGACCGGTCGATC
GGTTCAGCAGCGGCATGATCTCGTCAGCAGCGGCCCAGCTGTACCCACAGGCGCTGCAGGAGCAGGGCAAGACCGGAGGG
GCGGATGGATCGGCAGACGGGCCGCCGGTGAAGAAGTTCAAGAAGATCAAAGCGACGAAGCAGCTGGAGGCGGGCAAGAG
CAAGTGGCAGGAGTTCAACAGCAAGTCCAAGGTCGGCAAGACGATGACGAAAAAGGACAGCATGTTCCGGACGCCAGACG
GGATCCACGGGCGGGGTGAGTACCCTCTCTCACACACTTTCTGTCCTGCCGACTTCGTGTCTCTCTAACAGGTCTCAGTC
GGATTCACAGGCTCGGGCCAGGCCATGCGCAAAGACCCTACGAGAAGTCGACATATCTACCAGACCAATGAGGATCTGGA
CTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62