GenePrediction:GLEAN_7398 Details

Name: GLEAN_7398
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2337593..2335926 (- strand)
Length: 1668
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2337593..2337539 (- strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_140:2337475..2337337 (- strand)
Length: 139
Type: CDS
Source: GLEAN
Position: GCSC_140:2337009..2335926 (- strand)
Length: 1084
>GLEAN_7398 class=GenePrediction position=GCSC_140:2337593..2335926 (- strand)
ATGCCGAGTGCAAAGGGTCGTGCCCGCCTCTTCGCCGGAGAGCGCCCAGTGAAAGGTTTGTCTCAGGCGTCCATCTGTCG
GAGTATGTTCTTGTGTGCTGACTAGGCTTTGGCCACAGAGCTTGATCCCGAGGCAGAGGCGCCGCTTGAGGATGAGGACG
ACGCAAGTGAAAGCGAAGACGGCAAGGACGCCGTCGGGGCCGATACCGACCACTATGTCGCTGTTGGAAAGTCCAAGCTC
CGGCAAAAGCAGGCGCTGTCATTAGGACCAGCTTACAGAGGCGCACGCGTGAGCCGCGAGCAGCTTGAGCAAGACAGCGA
GGGCGATTTTGACGACGAGAATGACGACGACGAGGAAGAGGAAGAGGAAGAGTTTGACGACCCTGAGGATGTTGACGTCG
AAGGTGCCGAAGATGTCGACAATGACAATGACGGGGAAATCGACAGCGATGAGGCCTTTGGTTCGAGTGACGAGGAGATG
GTGCAGAAATTCACCTTTCGGGGTAGCTCAAAGCCGCGGGTTGCCGACGATGAGGATGAGGACGACGACGAAGACGACGA
AGATGAAGACGAGCTGAGCGACAGCGACATGGAGGATGACGAAGAAGTTGAGGGCGAAGTCGACCAAAAAACAGCCAAGG
CGCAAGCAGAGACGCGCAAGATCTTGGCCGAGGAGCGGCAACACATGCTGGCACCGATATCGCAGTCGGCCAAGGCGGAC
GCCGACAAGGGCTTTGCCGTGCGCCAGCAGCGCCGCACGTTTGACGCGCTGCTGAACATGCGCATCCGCATGCAAAAGGC
GCTGACGGCGTCCAACTCGCTGCACGTGGCCGCCGAGGAGGGCCGCGCCATGGATGCAGCTGTGGCAGAGAGCACGGCAG
CCGAGGCGATTGCGCTTCTGGCATCGATCCAGAGCATCCGTCAGTCGTTTTACATTGGCACCGAGACGTCGACAACCGAT
CCGAAGCAGAAGCGGAAGCGGAGTGACAACGACGATCGCTCGTGCGAAACCATCTTCCGCCAGATGGCCGAGACAGAAGA
GGCAGCACAGGGCAAGCGGAGAAGGGTGCTGGACCGATGGGCAATGCGGGTGCAGCGGCCATCGGCTTCAGGCGCGGGAT
CAGCGTCGGTCTCGAAACGATTCCAGCCATCGACCGGGACACAGGCTCTGACAGTCGTGCTGGACGAGCAGCTGGCCACG
GCCGAAGACCGACTGGTCCGGCGGACACGGGTGCCGCGATCCTGTGCTCCGGTGCAAGCGGCACGACGCGTGGCTGAGGA
CGCGGAGATCTACGATGACGCCGACTTTTACCAGCTGCTTCTCAAGGAGCTCGTCGACCAGCGCACGACTGACTCGTCAG
CACCCGGCAACGCCCTGCCCACGGTGCGCTGGGCGGCCTCGGCAGTCAAGGAGGCCAAGACCCGCAAGCTGGTCGACCGC
AAGGCCAGCAAGGGCCGCAAGATGCGCTTCAATGTGCACGAGAAGCTGCAGAACTTCATGGCGCCCGAGGACCGCCGCCA
GTGGGAGCCCGAGGCCATCGACCGGCTCTTCGGCACCATCTTTGGTCAGCGTGCCGAGCTGCACGAAGACGACGGCGACG
ACGGCGACAACGGCAGCGACAACGGCGTCAGCCCCGAGGAGGAGGGTCTGCGGTTGTTCCGCAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62