GenePrediction:GLEAN_7399 Details

Name: GLEAN_7399
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2334467..2331726 (- strand)
Length: 2742
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2334467..2334330 (- strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_140:2334244..2334233 (- strand)
Length: 12
Type: CDS
Source: GLEAN
Position: GCSC_140:2334147..2334104 (- strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_140:2334031..2333955 (- strand)
Length: 77
Type: CDS
Source: GLEAN
Position: GCSC_140:2333896..2333800 (- strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_140:2333733..2333578 (- strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_140:2333506..2333482 (- strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_140:2333409..2333132 (- strand)
Length: 278
Type: CDS
Source: GLEAN
Position: GCSC_140:2333070..2332823 (- strand)
Length: 248
Type: CDS
Source: GLEAN
Position: GCSC_140:2332766..2332531 (- strand)
Length: 236
Type: CDS
Source: GLEAN
Position: GCSC_140:2332471..2331870 (- strand)
Length: 602
Type: CDS
Source: GLEAN
Position: GCSC_140:2331804..2331726 (- strand)
Length: 79
>GLEAN_7399 class=GenePrediction position=GCSC_140:2334467..2331726 (- strand)
ATGGCTTCTTCTTGGAGGGGTCCCAAATTCGGCCTCGGCCTCGCCCTCGTCACCCTTTTCTGTCTCCTCTTCTCACCTGC
CTTTGTCGGCCAGGTGAGGGCAGACGAGGTCCAGGAATATGGCACCGTTATTGGCATTGTAAGTTTGCGCCCAGACAGAC
ACCACATCCATGCTTTTAGAAAAAAAGACTCCGAACAGTATGCTAACCCATTGGCCCTGACAGGATCTTGGCACCGTAAG
TTGGAGCTCCCAGCGATAAAGCCTCCGCCGAGCCTCGTTGCCGGTGGCGCAAGCTGCTACGTACGACTGACTTTCTCTAG
ACATACTCTTGTGTCGGTGTCATGCAAAAAGGCAAAGTGGAAATGTGAGTTAGAAGTGCCTTATCTCCACGTGGTGCAAA
GCAACGCGGGATTTCTTTTCTGACTCCGCCTTCCAGTCTTGTGAACGACCAGGGCCACCGTATCACCCCGTCATACGTCG
CATTTACCGAGGAGGAACGGTTGGTCGGTGATGGTATGTAGCTTTCTCTGCCGTGTCTGTTGTCTCGGTCGACTGCTAAC
CCTCCTTCCAGCGGCCAAGAACCAGGCTGCGAGCAACCCGGAGAAGACGATTTTTGACATCAAGCGCCTGATTGGACGCA
AGTTCTCCGAGAAGGACGTCCAGACTGAGTGCGTTACCGTCCCGTCTCTCGCATTCCAGGACCAAGTTCCGATTGACTAA
CCATGCACGAACAGCATCAAGCACTTCCCGTACAAGGTCGTCAGCAAGGCTGACAAGCCGGTTGTCAAGGTCGACGTCAA
GGGCGAGGAGAAGACCTTCTCGCCTGAGGAGATCTCCGGCATGATTCTCGGCAAGATGAAGGAGGTCGCCGAGGGCTACC
TTGGCAAGAAGTAAGCCATGCTCCATAGCCCCAGGGCTGTTGGCTTCCATTGGAAACGTGTCCGTACTAACCGACTACCA
GGGTCACGCACGCTGTCGTTACAGTGGTATGTTTGCAATTCGGCCTGTGGATGTCATGGGGACACGTAACTGAACAGCTA
CTGACAAACGGTTGACAGCCCGCGTACTTCAACGACAACCAGCGCCAGGCTACTAAGGATGCCGGCACTATCGCTGGCCT
GAATGTCCTGCGCATCGTCAACGAGCCCACTGCGGCTGCCATCGCCTACGGTCTTGACAAGACGGACGGCGAGCGCCAGA
TCATTGTGTACGACCTGGGTGGTGGTACCTTTGATGTGTCTCTCCTGTCCATCGACCAGGGCGTGTTCGAGGTTCTTGCG
ACTGCCGGTGACACTCATCTCGGTGGTGAGGATTTCGACCAGCGCATCATCAACCAGTATGTAGTCCCGTGTATGGTATA
CCGACGATCGCGTGTGAGCTAACAGGCATCTCCGCAGCTTCGCCAAGCAGTTCAACAAGAAGAACAGTGTCGACGTGACC
TCGGACAAGAAGGCCATGGGCAAGCTCAAGCGGGAGGCCGAGAAGGCCAAGCGCACTCTGTCTTCGCAGATGTCGACGCG
CATTGAGATCGAGTCCTTCTTCGGTGGCGAGGACTTCTCCGAGACGCTCACCCGGGCCAAGTTTGAGGAGCTGAACCTGG
ACCTGTTCAAAAAGACGCTGAAGCCTGTCGAGCAGGTTCTCAAGGGTAAGTCTGCCTGTTTCTTCCCTCCGTGAATGAAG
GACGAGCTAACTCGGTATTAGACGCCAAGGTCAGCAAGTCTGAGATTGACGACATTGTGCTCGTCGGTGGCTCTACCCGT
ATCCCCAAGGTCATCTCGCTTCTGGAGGAGTTTTTTGGCGGCAAGAAGGCCAGCAAGGGTATCAACCCCGATGAGGCCGT
CGCTTTCGGCGCCGCCGTCCAGGCCGGTGTTCTGTCTGGCGAGGAGGGCACTGAGGAGATTGTGCTGATGGACGTCAACC
CGCTCACTCTCGGAATTGTACGTGGCTCACAAAGACGCCCTCTCCTTCTGCACACGTCTTACTAACGGCACAACAGGAAA
CGACTGGTGGCGTGATGACCAAGCTGATCAACCGGAACACGCCCATCCCGACGCGCAAGTCGCAGATCTTCTCGACTGCG
GCCGACAACCAGCCAGTGGTCCTGATCCAGGTGTTTGAGGGCGAGCGTAGCATGACCAAGGACAACAACATCTTGGGCAA
GTTCGAGCTCACCGGCATCCCGCCAGCACCGCGTGGCGTCCCGCAGATCGAGGTGTCGTTTGAGCTCGATGCCAACGGCA
TCTTGAAGGTGTCTGCCCACGACAAGGGCACTGGCAAGAGCGAGAGCATCACGATCAACAACGACAAGGGCCGGCTTACG
CAGGACGAGATCGACCGCATGGTTGCCGAGGCAGAGAAGTATGCCGAGGAGGACAAGGCGACCCGCGAGCGCATTGAGGC
GCGCAACGGTCTGGAGAACTACGCCTTCTCGCTCAAGAACCAGGTCAGCGACGAGGACGGTCTGGGCGGCAAGATCAGCG
AAGAGGACAAGGAGACGCTCATCGAGGCCGTCAAGGAGACGCAGGAATGGCTGGACGAGAACGCGGCCACGGCCGATACG
GAGGACTTTGAGGAGCAGAAGGAGAAGCTGTCCAACGTGTAAGTGTGCACCGAGAGGGCCAGCGGGCGATTTTTGAAGCT
GTCTGCTAACCACCAACCAACAGGGCATACCCTATCACGAGCAAGATGTACAGCCAGGCCGGCGGCGATGACGACGAGCC
GAGCGGCCACGACGAGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62