GenePrediction:GLEAN_739 Details

Name: GLEAN_739
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1792187..1794028 (+ strand)
Length: 1842
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1792187..1792239 (+ strand)
Length: 53
Type: CDS
Source: GLEAN
Position: GCSC_97:1792334..1792431 (+ strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_97:1792512..1794028 (+ strand)
Length: 1517
>GLEAN_739 class=GenePrediction position=GCSC_97:1792187..1794028 (+ strand)
ATGACCGTCCAGACCGTTGAGTTTACGCCCTTCAGCGACCAGAAGCCGGGAACGTGAGTGTTTTTCTCTCTTGTCCACGA
TTTCTTCTCGGTCGAAAGATCTTCTGGTCGAGACCGCCAGTTCGGGAGCTGTGCTGACAGTCTGCAGGTCCGGTCTTCGT
AAGAAGGTCACTGTCTTCCAGCAGAAGCACTACAGCGAGTCGTTCATCGCCAGCATCATCCTGTCCATCCCCGAGGGCGC
CGAGGGTCAGTTCACAGGGAAAGAGCCGAGAGCTGAGGGCTGAAAGGCAAACAAGGAGGACAACAGTAGCTGACCGCCAT
TCCAGGTGCCTCGCTCGTGATCGGTGGTGATGGCCGCTACTACAACCCGGAAGTGGTGCAGCTGATCGCACGGATCGCCC
CGGCATACGGCGTTAAGAAACTGCTGATCGGACAGCATGGCATCCTCTCGACGCCGGCAGCCAGCCATCTGATCCGCAAG
CGCAAGGCGACGGGCGGCATCCTGCTGACGGCCAGCCACAACCCGGGCGGGCCCAAGGCAGATTTTGGCATCAAGTACAA
CCTGGCCAACGGTGGGCCGGCGCCCGAGTCGGTGACGAACCGCATGTTCGCCACGGCCAAGGCGCTGACTGAGTACAAGC
TACTGCCGCTGGACGTCGACGTCGACACGACGACGGTGGGCGTGCGAAGCTACGGCGCGCTCGAGGTGGAGATCGTCGAC
AGCACGGCCGACTACGTCGCCATGCTCGAGGACATCTTCGACTTCGACCTCATCCGCAGCTTTTTCCGCGCTCATTCCGA
CTTCCGCGTCCTCTTTGACGGGCTTCACGGCGTCACCGGGCCGTACGGCAAGGCCATCTTTTTCGAGGCGCTCGGACTCG
GTCCTGCCAGCGTCCAGAACTGTGAGCCCAGCCCTGACTTTGGTGGCGGCCACCCGGATCCCAACCTGACGTATGCCCAC
TCGCTCGTCGACGCGGTCGAGAAGGACCAGGTTCCCTTTGGCGCTGCCTCCGACGGTGATGGCGACCGCAACATGATCTA
CGGTGCCGGCGCCTTTGTCTCGCCCGGCGACAGCCTCGCCATCATCGCTCACCACGCACAGCTGATCCCCTACTTCCGCC
GCAACGGCGTCTACGGCCTCGCCCGCAGCATGCCCACTTCGGGCGCTGTTGATCTCGTGGCCAAGAAGCAAGGCCTGCAG
TCGTACGAGGTTCCGACCGGCTGGAAGTTCTTCTGCGCCCTCTTTGACGCCGACAAACTCTCGATCTGCGGCGAGGAGAG
CTTCGGCACCGGTAGCAACCACATCCGCGAAAAGGACGGCCTCTGGGCCATTGTCGCCTGGCTCAACATCATCGCCGGTC
TCGGCACTGCCAACCCGGCTGTCACGCCGACCATCCGCCAGATCCAGACCGACTTCTGGGCTGAGTACGGCCGCACCTTC
TTCACCCGCTACGACTACGAGAACGTCGACTCGGACGGCGCCGCCAAGGTCGTTGGTGTCCTCCGCGACCTCATCGCCGA
TCCGGCCTTTGTCGGCAGCTCCGTCGATGGTCGCCAGGTCACCGAGGCCGGCGACTTCTCCTACACCGACCTTGACGGCT
CTGTCTCCGACCACCAGGGCCTCTTCGTCCGCTTCGGCAACGGCACCCGCATCGTCGTCCGCCTGTCCGGCACTGGATCC
AGCGGCGCCACCATCCGCCTCTACATTGAGCAGCACAGCAACGACCCTGCCACCTACGACAAGGATGCCCAGGATGTGCT
CAAGCCCGAGATCCACCTGGCCACCACGCTGCTCAAGTTCAAGGAGTTTGTCGGCCGCGACGAGCCCGACGTCAAGACGT
AG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62